Slayt 1 - Biyoloji Kutusu

advertisement
KALITIM
KALITIM İLE İLGİLİ
KAVRAMLAR
Genetik
•
•
Bir canlıdaki özelliğin bir kuşaktan
diğerine aktarılmasına kalıtım,
Kalıtım ile ilgilenen biyoloji alt dalına ise
Genetik adı verilir.
Kalıtım ile ilgili Kavramlar
•
Karakter:
Bir nesilden diğer nesile aktarılabilen ve tür
içinde çeşitlilik gösteren özelliklerdir.
Gen:
•
Yüksek sayıda nükleotitin oluşturduğu bilgi
bloklarıdır.
•
Kalıtım Bilgisi bir Kitap ise, gen o kitaptaki her
bir cümledir.
Kalıtım ile ilgili ilk araştırmalarda DNA
üzerinde hiçbir bilgiye sahip olunmadığı
için gen yerine kalıtsal faktör kavramı
kullanılıyordu.
Lokus:
•
Genlerin kromozomlar üzerinde bulunduğu
fiziksel bölgelerdir.
Gen, bilgiyi ifade eder.
Ör:
ATGCTTAGCCTAGCTAATTT….
Lokus ise bulunduğu bölgeyi.
ALEL GENLER
(KARŞILIKLI GENLER)
•
•
Lokusları, homolog kromozomlar
üzerinde karşılıklı olarak bulunan
genlerdir.
Aynı karakter üzerinde etkilidirler.
Mavi göz geni
Kahverengi göz geni
Çoğu zaman gen kelimesi
ile alel kelimesi
Eş anlamlı olarak
kullanılabilmektedir.
Mor renk aleli
Lokuslar
Homolog kromozom
çifti
Beyaz renk aleli
Dominant (baskın)Gen:
•
•
Her durumda sahip olduğu karakter özelliği
ortaya çıkan gendir.
Büyük harf ile gösterilir.
Resesif (Çekinik)Gen:
•
•
Sadece homozigot durumda iken karakteri
özelliği ortaya çıkan diğer durumlarda
karakter özellikleri belli olmayan gendir.
Küçük harf ile gösterilir.
Bezelyelerde tohum rengini belirleyen genler.
S: Sarı renk
s: Yeşil Renk
Genotip 
Fenotip 
Homozigot
Heterozigot
SS ss
Ss
Homozigot:
•
•
Belirli bir karakterin alel genlerinin
ikisine de sahip olan bireydir.
Örnek:Aşağıdaki bezelye, tohumun düzgünlüğü
karakteri konusunda homozigotdur.
DD
Heterozigot:
•
•
Belirli bir özellik üzerindeki alel genleri
farklı olan bireydir.
Örnek: Kan grubu konusunda heterozigot olan
birey.
AB
Genotip:
•
Bir canlının genetik durumudur.
Fenotip:
•
Bir canlının dışarıdan gözlemlenebilen
özellikleridir.
Bezelyelerde tohum rengini belirleyen genler.
S: Sarı renk
s: Yeşil Renk
Genotip 
Fenotip 
Homozigot
Heterozigot
SS ss
Ss
OLASILIK İLKELERİ
•
Olasılık ölçüsü 1 ile 0 arasındadır.
İstatistik sonuçları olasılık ile
doğrudan ilişkidir.
Birbirinden
bağımsız olayların aynı anda
gerçekleşme olasılığı,
bu olayların gerçekleşme
olasılıklarının çarpımına
eşittir.
Ör:
•
Havaya bir para atılıyor ve bundan sonra yere
bir zar atılıyor.Paranın tura, zarın ise 3 gelme
olasılığı kaçtır ?
•
½ X 1/6 = 1/12
Eğer bir olay farklı yollar ile
gerçekleşebiliyorsa, bu
yolların her birinin
oluşturduğu olasılıkların
toplamı istenilen olayın
gerçekleşme olasılığını verir.
Ör:
•
Yere 3 zar atılıyor.Atılan zarlarda herhangi
birisinin 5 gelme olasılığı nedir ?
•
1/6 + 1/6 + 1/6 = 3/6 = 1/2
Gregor Mendel
kimdir ?
1822-1884
Mendelin Hayat Hikayesi
•
•
•
•
•
•
1822’de Avusturyada Doğdu.
Babası küçük bir çiftçi olan Mendel bahçe işleriyle çok
uğraşmıştır.
1840-43 yılları arasında Olomütz üniversitesinde
teoloji bölümünde okudu.
1843 yılında St.Thomas Manastırına girdi ve papaz
oldu.
Bir süre semt papazlığı yaptı ama pek başarılı olamadı.
1851 yılında Viyana Üniversitesine gitti ve fen
bilimleri okudu.Fen Bilimleri öğretmenliği için gerekli
olan sınavı veremedi.
•
1853 yılında (31 yaşında) tekrar manastıra
döndü ve bitkiler üzerinde genetik
çalışmalarına başladı.
Mendel İlkeleri ve Uygulamaları
•
Mendel, belirli karakterlerin oluşum oranlarına
bakılarak meydana gelme olasılıklarının
belirlenebileceğini öngörmüştü.
•
Karakterlerin ortaya çıkma olasılıklarının
bulunmasıyla kalıtımın nasıl bir şekilde
aktarıldığının anlaşılabileceğine inanıyordu.
Kalıtımı incelemek için;
•
•
•
Çabuk büyüyüp yetişen,
Çok fazla döl veren,
Belirgin karakterlere sahip bir canlı üzerinde
çalışmak gerekir.
Mende
Kalıtım’ın canlıdan canlıya nasıl
aktarıldığını anlamak için
gerekenler
•
•
•
İyi bir matematik bilgisi,
Bol miktarda bezelye,
İyi bir sabır.
•
Mendel 8 yıl boyunca toplamda 29.000
bezelye ekip biçerek ve sonuçta oluşan döllerin
karakterlerin istatistiksel hesaplarını yaparak
Mendel Kanunlarını ortaya çıkardı.
Mendel bezelyeler üzerinde
nasıl bir çalışma yaptı ?
•
Mendel önce bezelyeler üzerinde
çalışılabilecek 7 karakter belirledi.
Tohum
Çiçek
Tohum Zarfı
Gövde
Şekil
Renk
Renk
Şekli
renk
Ç. Durumu Uzunluk
Düz
Sarı
Beyaz
Yassı
Sarı
Aksiyal
Buruşuk
Yeşil
Mor
Kıvrık
Yeşil
Terminal
Uzun
Kısa
•
•
Daha sonra belirli karaktere sahip olan
bezelyelerin kendi kendine döllenmesini
sağladı.
Bazılarının ise çapraz döllenmesini sağladı.
Kendi kendini
dölleme
Çapraz
Dölleme
MENDELİN PROBLEMLERİ
•
TEMEL PROBLEM:
Kalıtım, atadan yavru bireye nasıl aktarılır ?
X
Hepsi Mor
Beyaz özelliğe ne oldu ?
X
Bazısı Beyaz Bazısı Mor
Neden bazı mor çiçekli bezelyeler beyaz
Özelliği ortadan kaldırırken, diğerleri beyaz
Çiçek özelliğinin ortaya çıkmasını sağlıyor ?
X
Hepsi Mor
Sorun yok.
X
Bazısı Mor, bazısı beyaz.
Neden Bazı mor çiçekli bezelyeler
Çaprazlandığında, döllerin bazısı beyaz
Çiçekli oluyor ?
P kuşağı
X
F1 kuşağı
X
F2 kuşağı
Varılan sonuçlar?
•
•
•
•
Demek ki beyaz çiçek özelliği ortaya çıkmasa
bile bir şekilde oluşan dölün kalıtımında
bulunuyor.
Bazı karakterler, diğer karakterlere göre
çekiniktir.
Bazı bireyler, sadece bir karakter özelliği
taşırlar.
Bazı bireyler ise hibrittir.Bir karakter özelliği
gösterir fakat iki karakter özelliğine sahiptirler.
•
Oluşan döller üzerinde karakterlerin
oluşumu ve dağılımı üzerine bir kural var
mıdır ?
Monohibrit
Çaprazlama
•
•
•
Hibrit:Çekinik karakterleri taşıyan fakat
fenotipinde göstermeyen döllerdir.
Hibridizasyon:Hibrit döl oluşturma
yöntemidir.İki homozigot ebeveyn ile hibrit
döller oluşturulur.
Monohibrit:Sadece bir karakter üzerine melez
olan bireylerdir.
Homozigot meydana getirme
•
Sürekli olarak kendisi ile döllendirilen bireyler
ile homozigot(arı döl) bireyler meydana
getirilebilir.
P kuşağı
F1 kuşağı
Arı döl
(Homozigot)
Tekrar tekrar
kendileştirme
sonucu
Arı döl
(Homozigot)
•
•
OLUŞTURULAN HOMOZİGOT BİREYLER
ÇAPRAZLANIR.
ÇAPRAZLAMA SONUCU OLUŞAN
MONOHİBRİT BİREYLERİN OLUŞMA
OLASILIKLARI HESAPLANIR.
P kuşağı
(ebeveynler)
F1 kuşağı
(hibritler)
F2 kuşağı
705 Mor Çiçekli
224 beyaz çiçekli
Hatırlatma
•
•
Büyük ölçekli istatistiksel sonuçlar, olasılıklar
ile aynı oranı verir.
Örnek:
• Bir zigotun erkek veya dişi olma olasılığı ve
dünyada kadın ve erkek nüfusunun birbirine oranı
eşittir.
•
Mendel istatistiksel hesaplamalar yaparak döl
oluşumu üzerinde bir kural bulunabileceğini
düşünmüştür.
KARAKTER
Çiçek Rengi
Tohum
Rengi
Tohum
Şekli
Tohum
Zarfı Rengi
Tohum
Zarfı Şekli
Çiçek
Pozisyonu
Çiçek
Yüksekliği
BASKIN & ÇEKİNİK
F2 kuşağı baskın
ve çekinik sayısı
Oran
Peki bütün bunlar
ne anlama geliyor ?
Mendel elde ettiği gözlemler
ve istatistiksel kurallar ile
Mendel Kanunlarını ortaya
çıkarmıştır.
Mendel Kanunları ile şu sonuçlara ulaşılmıştır.
•
•
•
•
Karakterler canlılarda bulunan kalıtsal
faktörler(gen) ile belirlenir.
Her canlıda karakter’i belirleyen bir çift gen
bulunur.Bu gen çiftleri alel genlerdir.
Bu alel genler aynı da olabilir farklı da olabilir.
Eğer genler aynı ise bu birey bu özellik
açısından homozigot,farklı ise heterozigot’dur.
•
Alel genler farklı ise ve bu iki farklı genden biri
fenotip’i belirliyorsa, bu gen baskın(dominant)
gendir.
•
Heterozigot durumda fenotip’i etkilemeyen
gen ise çekinik(resesif) gendir.
Bezelyelerde tohum rengini belirleyen genler.
S: Sarı renk Baskın gen
s: Yeşil Renk Çekinik gen
Genotip 
Fenotip 
Homozigot
Heterozigot
SS ss
Ss
Alel genler, gamet oluşumu
sırasında birbirinden ayrılır.
ss
SS
S
S
s
Ss
s S
s
Çaprazlamanın
Yazılış Şekli
P : MM
x
G:
M
F1:
%100 Mm
F1x F1 :
G:
mm
|
Mm x
M,m |
= M(Mor çiçek)
m
= m(Beyaz çiçek)
Mm
M,m
F2: MM,Mm,Mm,mm
Genotip :%50 Mm, %25 mm, %25 MM
Mendel Kanunları
1.Eşitlik(İzotipi) Yasası:
Birer karakteri farklı iki saf
(homozigot) ırk çaprazlandığı zaman
meydana gelen F1 dölünün
bireylerinin hepsi melez ve birbirine
benzer olur.
Sonuçta
Bir monohibrit döl başka bir monohibrit
Döl ile çaprazlanırsa oluşan
F2 döllerinin;
%75’yakını baskın,
%25’e yakını ise çekinik
özellik taşır.
Mendel Kanunları
2.Baskınlık (Dominant)Yasası:
Alellerden biri baskın diğeri ise
çekiniktir.
Heterozigot bir bireyde, baskın gen
genotipe etki eder, çekinik gen etki
oluşturmaz.
Bağımsız genler:
•
Aynı kromozom
üzerinde
bulunmayan
genlerdir.
A,a genleri ile
A,Bgenleri
genleribağımsız
ile
C,c
a,b
genleri bağlıdır.
genlerdir.
A
a
B
b
C
c
Bağımsız Genlere sahip olan
bir bireyin oluşturduğu gamet
n
çeşidi sayısı 2 formülü ile
belirlenir.
n=heterozigot duruma
sahip alel çift sayısı
Ör:
•
•
•
AaBBCc genotipli bir birey;
kaç farklı gamet oluşturabilir ?
Bu gametleri yazınız.
ALIŞTIRMALAR
Dihibrit Çaprazlama
•
İki karakter bakımından birbirinden farklı olan
bireyler arasında yapılan çaprazlamaya dihibrit
çaprazlama denir.
MENDEL KANUNLARI
3. Bağımsız Dağılım Yasası
•
Bir karakter üzerinde etkili
olan aleller rastgele bir
biçimde gametlere dağılır.
P:
SSDD
G:
F1:
ssdd
X
SD
SsDd
Genotip:
% 100 SsDd
Fenotip :
% 100 SD
sd
F1 x F1:
G:
SsDd
SD,Sd,sD,sd
x
SsDd
SD,Sd,sD,sd
SD
S
s
Sd
sD
sd
Genotip :
SSDD
SSDd
SSdd
ssDD
ssDd
ssdd
SsDd
Ssdd
SsDD
SD
Sd
sD
sd
F2 :
SD
SSDD
SSDd
SsDD
SsDd
Fenotip:
Sd
SSDd
SSdd
SsDd
Ssdd
sD
9/16 Sarı-Düz
SsDD
SsDd
ssDD
ssDd
3/16 Yeşil-Düz
sd
SsDd
Ssdd
ssDd
ssdd
3/16 Sarı-Buruşuk
1/16 yeşil-Buruşuk
Monohibrit
Dihibrit
Çaprazlama Çaprazlama
Fenotip Çeşidi
Fenotip Oranı
Genotip Çeşidi
Genotip Oranı
2
3:1
3
1:2:1
4
9:3:3:1
9
(1:2:1).(1:2:1)
Alıştırmalar
Soy Ağacı ile Kalıtımın
Gösterilmesi
Fenotipinde, izlenen özellik görülmeyen
erkek birey.
Fenotipinde, izlenen özellik
Fenotipinde,
izlenen erkek
özellikbirey.
görülmeyen
görülmeyen
Dişi birey.
Fenotipinde, izlenen özellik görülen
erkek birey.
Alıştırmalar
Bu Bezelye
Homozigot mudur ?
Yoksa heterozigot mu
Kontrol Çaprazlaması
X
MM
mm
Hepsi Mor
Bu durumda diyebiliriz ki, Çaprazlanan
Mor çiçekli bezelye Homozigotdur.
X
Mm
mm
Bazısı Beyaz Bazısı Mor
Bu durumda diyebiliriz ki, Çaprazlanan
Mor çiçekli bezelye Heterozigotdur.
Kontrol Çaprazlaması
•
•
Baskın bir özelliği taşıyan bir bireyin homozigot
mu yoksa heterozigot mu olduğunu anlamak
için çekinik yönden homozigot bir birey ile
çaprazlanır.
Buna kontrol çaprazlaması adı verilir.
Mendel Genetiğinin
Genişletilmesi
1.Eksik Baskınlık
2.Eş Baskınlık
3.Çok Alellilik
1.Eksik Baskınlık
•
•
Alel genlerin birbirlerine üstün gelememesi ve
sonuçta her alelin fenotip üzerinde bir miktar
etki oluşturmasıdır.
Bu durumda genler oluşturacakları özellikleri
karşılarındaki diğer alel yüzünden tam olarak
oluşturamazlar.
Aslanağzı Çiçeği
P kuşağı :
IK IK
IB IB
Gametler
IB
IK IB
F1 kuşağı :
Gametler
F2 kuşağı :
IK
Yumurta
IK
IB
IK
IB
IK
IB
Sperm
2.Eş Baskınlık
•
Eksik Baskınlıktan ayrı olarak burada her gen
alelinin etkisinde kalmaksızın kendi özelliğini
fenotipte ortaya çıkarır.
Fenotip
Genotip
M
MM
Alyuvarın zarındaki
Antijen
M antijeni
N
NN
N antijeni
MN
MN
M ve N antijeni
3.Çok Alellilik
•
Bir populasyonda aynı türe etki eden ikiden
fazla alelin bulunması durumuna Çok Alellilik
adı verilir.
Ör:insanda kan grupları
Fenotip
Genotip
AA,AO
Alyuvardaki
Antijen
A
Plazmadaki
Antikor
Anti-B
A
B
AB
0
BB,BO
AB
00
B
A,B
-
Anti-A
Yok
Anti-A,anti-B
A ve B eşbaskınlığa sahiptir.0 ise çekiniktir.
A kan grubu
Antijen A
B Antikoru
B kan grubu
AB kan grubu
0 kan grubu
Antijen B
Antijen A ve
Antijen B
Antijen yok
A Antikoru
Antikor yok
A ve B antikoru
Yüzey antijenleri + Karşıt Antikorlar
Aglütinasyon ve hemoliz
•
•
0 kan grubu genel vericidir.
AB kan grubu ise genel alıcıdır.
Peki, uyuşma olmayan kanlar bir araya
gelirse ne olur ?
•
•
Bu durumda kanlarda bulunan antikorlar
hedefindeki antijenlere saldırır ve sonuçta
kandaki alyuvarlar birbirine yapışarak, çökelir.
Bu duruma Çökelme(aglütinasyon) adı verilir.
Örnek:
•
A grubu bir kan ile B grubu bir kan
karışırsa sonuçta;
•
A grubu kandaki anti-B antikorları B grubu
kandaki B antijenlerine saldırır.
B grubu kandaki anti-A antikorları A grubu
kandaki A antijenlerine saldırır.
•
Tavşanlarda Çok Alellilik
C= Normal kürk rengi-Renkli yabani tip
cch=Gümüşi (şinşilla) kürk rengi- Açık gri tip.
ch= Himalaya tip-Gözleri pembe, vücutları
beyaz.
ca= Albino- Vücutları beyaz, gözleri pembedir.
C > cch > ch > ca
Alıştırmalar
aynı karakter üzerine etkili
5 alel gen ile kaç farklı
genotip oluşturulabilir ?
Diğer Kan Grupları
•
İnsanda ayrıca MN kan grubu ile Rh kan
grupları bulunur.
Alyuvarın zarındaki
Antijen
Fenotip
Genotip
M
MM
M antijeni
N
NN
N antijeni
MN
MN
M ve N antijeni
Rh Kan Grubu:
Fenotip
Genotip
Rh+
Rh-
RR,Rr
rr
•
Alyuvardaki
Antijen
Rh antijeni
yok
Plazmadaki
Antikor
yok
Anti-Rh
antikoru
Rh(+) kan grubu, Rh(-) kan grubuna karşı
baskındır.
Kan Uyuşmazlığı:
•
Eğer anne Rh(-) ve çocuğu Rh(+) olursa bu
durumda anne ile anne karnındaki çocuk
arasında kan uyuşmazlığı ortaya çıkar.
Rh(-) anne
Plesenta
İkinci
Rh(+)
Fetüs
İlk Rh(+)
fetüs
Rh
antijenleri
İlk Gebelik
İki Gebelik arası
İkinci Gebelik
Eritroblastosis fetalis
•
•
•
İlk gebelikte bir sorun çıkmaz fakat diğer
gebeliklerde Rh antijeni görmüş olan annenin
bağışıklık sistemi 2. ve diğer çocuklardaki
alyuvarlara karşı Rh antikoru oluşturur.
Sonuçta fetüsün alyuvarları, annenin bağışıklık
sistemi tarafından oluşturulan antikorlar
tarafından parçalanır.
Bu hastalığa Eritroblastosis fetalis adı verilir.
Alıştırmalar
PLEİTROPİ
Bir genin birçok fenotip
üzerine etkili olmasına
pleitropi adı verilir.
Tek Gen
Etki 1
Etki 2
Çoklu Etki
Etki 3
Download
Random flashcards
Merhaba

2 Cards oauth2_google_861773e1-0890-4522-834a-6a5babb58e76

qweeqwqwe

5 Cards oauth2_google_78146396-8b44-4532-a806-7e25cc078908

En Mimar Architecture LTD ŞTİ XD

2 Cards asilyasar069

Terimler

2 Cards oauth2_google_ef32970e-e5f9-4595-9abe-394e9f6bc8d9

Create flashcards