l hastalarda endoserv‹kal chlamyd‹a pcr sonuçları

advertisement
‹NFERT‹L HASTALARDA ENDOSERV‹KAL CHLAMYD‹A PCR SONUÇLARI
Ercan YILMAZ*, Ahmet ERDEM*, Aydan B‹R‹L*, Gülendam BOZDAYI**,
Banu B‹NGÖL***, Bora DO⁄AN****, Nuray BOZKURT*
* Gazi Üniversitesi T›p Fakültesi Kad›n Hastal›klar› ve Do¤um Anabilim Dal›, Ankara
** Gazi Üniversitesi T›p Fakültesi Mikrobiyoloji Anabilim Dal›, Ankara
*** ‹stanbul Bilim Üniversitesi Metropolitan Florance Nigthingale Hastanesi
**** Ankara Numune Hastanesi Mikrobiyoloji Bölümü
ÖZET
Amaç: Tubal faktör etyopatogenezinde sorumlu tutulan C. Trahomatis s›kl›¤›n›n Türk infertil populasyonunda endoservikal
sürüntüden PCR yöntemi ile de¤erlendirilmesi.
Gereç ve Yöntem: Gazi Üniversitesi T›p Fakültesi Kad›n Hastal›klar› ve Do¤um Klini¤ine infertilite tan›s› ile baflvuran 61 hastada
histerosalpingografi (HSG) ifllemi s›ras›nda al›nan endoservikal örnekte C. Trahomatis PCR pozitifli¤i ile hastalar›n HSG sonuçlar›
karfl›laflt›r›ld›.
Bulgular: Hastalar›n 27’si (% 44) primer ve 34’ü (% 56) sekonder infertildi. Primer infertil hasta grubunda 5 hastada (%18),
sekonder infertil hasta grubunda ise 8 hastada (% 23) endoservikal C. Trahomatis PCR pozitif olarak saptand›. HSG’de tubal
faktör saptanan 16 hastadan 3’ünde (% 18.7), tubal patoloji olmayan 45 hastadan ise 10’unda (% 22.2) C. Trahomatis PCR
yöntemi ile pozitif sonuç al›nd›. Proksimal ve distal tubal obstrüksiyonu olan hastalar ayr› olarak de¤erlendirildi¤inde ise, distal
tubal obstrüksiyon saptanan 9 hastadan 3’ünde (% 33.3) C. Trahomatis PCR pozitif olarak saptan›rken, proksimal obstrüksiyon
saptanan 7 hastan›n tamam›nda C. Trahomatis PCR negatif olarak saptand›. Yaln›zca distal tubal hasar› olan hastalar dikkate
al›nd›¤› zaman sensitivite % 33.3, spesifite, %77.7, pozitif prediktif de¤er, %23, negatif prediktif de¤er, %85.3 olarak saptand›.
Sonuçlar: ‹nfertil hastalarda C. Trahomatis PCR sonuçlar›n›n distal tubal hastal›¤› saptamada sensitivitesi düflük ancak spesifitesi
ve pozitif prediktif de¤eri yüksektir.
Anahtar kelimeler: histerosalpingografi, ‹nfertilite, K. Trahomatis, tubal faktör
Türk Jinekoloji ve Obstetrik Derne¤i Dergisi, 2008; Cilt: 5 Say›: 1 Sayfa: 51- 6
SUMMARY
Endocervical chlamydia PCR results in infertile patients
Aim: Our aim was to evaluate the frequency of C. Trachomatis - a microorganism held responsible in the etiopathogenesis of tubal
infertility factor- in the turkish infertile population, using the PCR procedure on endocervical smear samples.
Materials and Methods: In 61 patients presenting with infertility to Gazi University Faculty of Medicine, Obstetrics and Gynecology
Department, samples were taken prior to the Hysterosalphingography (HSG) procedure. These samples were then checked for
C. Trachomatis via PCR and positive test results were later compared with HSG outcomes.
Results: 27 (44%) of the patients were primary infertile and 34 (56%) were classed as being secondary infertile. 5 patients (18%)
in the primary infertile group, and 8 patients (23%) in the secondary infertile group tested PCR positive for C.trachomatis in their
Yaz›flma adresi: Uzm. Dr. Ercan Y›lmaz. Gazi Üniversitesi T›p Fakültesi Kad›n Hastal›klar› ve Do¤um Anabilim Dal›, Beflevler, 06500, Ankara
Tel.: (0312) 202 59 29
e-posta:[email protected]
Al›nd›¤› tarih: 05.10.2007, revizyon sonras› al›nma: 16.01.2008, kabul tarihi: 21.01.2008
51
Ercan Y›lmaz ve ark.
endocervical samples. Out of the 16 patients with a tubal infertility factor evident with HSG, 3 patients (18.7%) tested positive
for C. Trachomatis, and out of the 45 patients showing no tubal pathology 10 patients (22.2%) were positive for C. Trachomatis.
When patients with proximal and distal tubal obstruction were individually evaluated; of the 9 patients with distal tubal obstruction,
3 (33,3%) patients had a positive PCR result for C. Trachomatis and all of the 7 patients with proximal tubal obstruction tested
PCR negative for C.trachomatis. When patients with a distal tubal pathology were evaluated alone, this test showed a sensitivity
of 33.3%, a spesificity of 77.7%, a positive predictive value of 23% and a negative predictive value of 85,3%.
Results: The evaluation of C.trachomatis with PCR in infertile patients showed low sensitivity but high specificity and positive
predictive value in finding distal tubal pathologies
Key words: C. Trachomatis, hysterosaphingography, infertility, tubal factor
Journal of Turkish Society of Obstetric and Gynecology, (J Turk Soc Obstet Gynecol), 2008; Vol: 5 Issue: 1 Pages: 51- 6
en yüksek olan yöntem PCR’d›r (10).
Biz bu çal›flmada tubal faktör etyopatogenezinde
sorumlu tutulan K.Trahomatis s›kl›¤›n›n Türk infertil
populasyonunda endoservikal sürüntüden PCR yöntemi
ile de¤erlendirilmesi ve sonuçlar›n HSG bulgular›yla
karfl›laflt›r›larak K. Trahomatis PCR sonuçlar›n›n tubal
faktörü öngörmedeki duyarl›l›¤›n› saptamay› amaçlad›k.
G‹R‹fi
K. Trahomatis, tüm dünyada en yayg›n seksüel geçiflli
bakteriyel enfeksiyon ajan› olarak bilinir (1) . K.
Trahomatis enfeksiyonu, bayanlarda alt genital sistemde
servisit ve üretrite neden olur iken, üst genital sistemde
ise endometrit ve salpinjite neden olur(2). K Trachomatis
geliflmifl ülkelerde tubal infertilitenin en s›k sebebidir
(3)
ve tubal faktör, tüm infertil populasyon göz önüne
al›n›rsa geliflmifl ülkelerde %10-30 oran›nda (4) ,
GEREÇ ve YÖNTEM
geliflmekte olan ülkelerde ise % 80’e varan oranlarda
infertiliteye neden oldu¤u bilinmektedir(5).
K. Trahomatis, genellikle kolumnar epiteli istila eder,
tuba uterinalar›n ampullar segmentlerinde yo¤un olarak
intrasellüler formda kal›r. Böylece, ço¤unlukla distal
tubal hasara neden olarak infertiliteye yol açar(6). Tubal
Gazi Üniversitesi T›p Fakültesi Kad›n Hastal›klar› ve
Do¤um Klini¤ine infertilite tan›s› ile baflvuran 61
hastadan histerosalpingografi (HSG) ifllemi s›ras›nda
al›nan endoservikal örnekte K.Trahomatis PCR
pozitifli¤i ile hastalar›n HSG sonuçlar› karfl›laflt›r›ld›.
Hastalar›n 27’si (% 44) primer ve 34’ü (% 56) sekonder
infertildi. Hastalardan K.Trahomatis identifikasyonu
için s›ras›yla flu ifllemler uyguland›.
Örnekler: Steril aspiratör ile y›kanan douglasdan al›nan
sitolojik y›kama materyali steril fosfat tampon
solüsyonu (PBS [pH 8.0]) içerisine aktar›larak
mikrobiyoloji laboratuvar›na ulaflt›r›lm›flt›r. Ve çal›flma
zaman›na kadar -20C de depolanm›flt›r.
DNA elde edilmesi: Fenol- kloroform- izoamilalkol
ile DNA saflaflt›r›lmas› yap›l›p ard›ndan 3M sodyum
asetat içeren saf etanol eklenerek -20C’de bir gece
bekletilerek çöktürme ifllemi gerçeklefltirilmifltir . Elde
edilen DNA hemen ço¤alt›lmayacaksa -20C’ye
kald›r›lm›flt›r.
DNA’n›n ço¤alt›lmas›: Bu çal›flmada Klamidya’ya
özgül primerleri içeren ço¤altma kar›fl›m› (amplifikasyon miski) kullan›larak 2 turlu PCR yap›larak
klamidya DNA’lar› elde edilmifltir. Ço¤alt›lan ürünler
etidyum bromid içeren %1.5’luk agaroz jelde
yürütülmüfl ve sonra UV transiluminatör alt›nda
hasar infertilitenin en yayg›n nedenidir ve tan›da
laparoskopi veya histerosalpingografi yöntemleri
uygulanabilir(7). Laparoskopi, tubal patoloji tan›s›nda
alt›n standart olarak kabul edilir(7). ‹nfertilite tan›s› ile
yap›lan diagnostik laparoskopi de eksplorasyonda,
fimbrial yap›fl›kl›k, tubal oklüzyon, pelvik adezyonlar
izlenebilir. Hücre içinde yerleflim gösterdi¤i için
K.Trahomatis’in dokudan izolasyonu oldukça güçtür.
En uygun ve kesin sonuç veren yöntem doku
kültürlerinde K.Trahomatis sufllar›n›n üretilmesidir.
Doku kültürleri, DNA amplifikasyon teknikleri ile
karfl›laflt›r›ld›¤› zaman K. Trahomatis izolasyonu
aç›s›ndan sensitivitesinin daha düflük oldu¤u anlafl›lm›flt›r(9). DNA amplifikasyon teknikleri içinde, sensitivite
ve spesifitesi yüksek olan Polymerase Chain Reaction
(PCR) yöntemi en yayg›n tan› yöntemi olarak
kullan›lmaktad›r (9) . C. Trahomatis Amplicor
Polymerase Chain Reaction (APCR), Ensime Immun
Assay (ELISA), C.Trahomatis Antibody Titre (CAT)
gibi yöntem-lerle de tespit edilebilir. Ancak, sensitivitesi
TJOD Derg 2008; 5: 51- 6
52
‹nfertil hastalarda endoservikal chlamydia PCR sonuçlar›
Tablo I: Tubal patoloji saptanan hastalarda K. Trahomatis PCR
klamidya için 250 bp uzunlu¤unda C. Trachomatis’e
ait band aranm›flt›r.
sonuçlar›
HSG
Tubal faktor En az bir tüpte
En az bir tüp
yok
distal obstrüksiyon proksimal
obstrüksiyon
Kullan›lan primerler;
1. tur primerleri
Primer 1F
5’ GGGATTCCTGTAACAACAAG 3’
Primer 1R
5’ TCCTCAGAAGTTTATGCACT 3’
2.tur primerleri
Primer 2F 5’ GTGTTCTTATTGTTCTGGGG 3’
Primer 2R 5’ TGACGGAGTACAAACGCCTAG 3’
Hasta sonuçlar›n›n de¤erlendirilmesinde istatistiksel
analiz için The Statistical Program for Social Sciences
(SPSS, version 11.5; SPSS Inc., Chicago, IL, USA)
program› kullan›ld›.
Klamidya Negatif
(PCR)
Hasta Say›s›:
%:
35
77.8
6
66.7
7
100
Klamidya Pozitif
(PCR)
Hasta Say›s›:
%:
10
22.2
3
33.3
0
Total
Hasta Say›s›:
%:
45
100
9
100
7
100
TARTIfiMA
Pelvik inflamatuar hastal›k (PID) tubal kaynakl›
infertilitenin en önemli nedenidir.
En önemli PID etkenleri olarak C. Trahomatis,
N.Gonorrhoeae, yada her ikisinin neden oldu¤u
hastal›klar say›labilir(6). Literatürde yap›lan çal›flmalar,
BULGULAR
Klini¤imize infertilite nedeni ile baflvuran 61 hastadan
HSG ifllemi öncesinde endoservikal smear örnekleri
al›nd›. Bu örneklerden PCR yöntemi ile K. Trahomatis
identifiye edilmeye çal›fl›ld›. Hastalar›n 27’si (% 44)
primer ve 34’ü (% 56) sekonder infertildi. Primer
infertil hasta grubundan, 5 hastada (%18), sekonder
infertil hasta grubundan ise 8 hastada (% 23)
endoservikal K. Trahomatis PCR pozitif olarak
saptan›rken iki grup aras›nda istatistiksel olarak anlaml›
fark saptanmad› (p<0.05). HSG’de tubal faktör saptanan
16 hastadan 3’ünde (% 18.7), tubal patoloji olmayan
K.Trahomatisin eradikasyonu ile pelvik inflamatuar
hastal›klar›n yar›s›ndan fazlas›n›n önlenebildi¤ini
göstermifltir(11). PID önemli bir klinik sorundur ve
tubal faktör ba¤›ml› infertilitenin ve ektopik gebeli¤in
en önemli nedenlerindendir(11). Weström’ün yapt›¤›
klinik çal›flmalar; reprodüktif hayat› boyunca bir kez
PID ata¤› geçiren hastada tubal faktöre ba¤l› infertilite
geliflme insidans›n›n %10, iki kez PID ata¤› geçirmesi
durumunda tubal infertilite geliflme insidans›n›n %20,
üç kez PID ata¤› geçirmesi durumunda bu oran›n %40
ve üzerinde oldu¤unu göstermifltir(10). Tubal patolojiye
45 hastadan ise 10’unda (% 22.2) klamidya PCR
yöntemi ile pozitif sonuç al›nd›; gruplar aras›nda fark
saptanmad›.
K.Trachomatis PCR’›n HSG’de tubal faktörü önceden
bildirmede sensitivitesi % 19, spesifitesi %78, pozitif
prediktif de¤er, % 23, negatif prediktif de¤er ise,% 73
olarak saptand›. Proksimal ve distal tubal obstrüksiyonu
olan hastalar ayr› ayr› de¤erlendirildi¤inde ise, distal
tubal obstrüksiyon saptanan 9 hastadan 3’ünde (%
33.3) K. Trahomatis PCR pozitif olarak saptan›rken,
proksimal obstrüksiyon saptanan 7 hastan›n tamam›nda
K. Trahomatis PCR negatif olarak saptand› (Tablo I).
Yaln›zca distal tubal hasar› olan hastalar dikkate al›nd›¤›
zaman sensitivite % 33.3, spesifite %77.7, pozitif
prediktif de¤er, %23, negatif prediktif de¤er, %85.3
olarak saptad›k.
ba¤l› infertite tan›s› alan hastalar›n ço¤u asemptomatiktir
ve PID tan›s› konamayabilir. Özellikle K. Trahomatise
ba¤l› PID olgular›n›n ço¤u asemptomatik ve
subkliniktir. Seroepidemiyolojik çal›flmalar K.
Trahomatise enfeksiyonu geçiren veya asemptomatik
tafl›y›c› olan hastalarda, K. Trahomatis antikorlar› ile
tubal patoloji aras›nda kuvvetli bir iliflki oldu¤unu
göstermifltir(6).
Hayat›nda bir kez yada daha fazla PID ata¤› geçiren
(özellikle K. Trachomatis kaynakl›) kad›nlar, normal
populasyona göre daha fazla tubal kaynakl› infertilite
tan›s› almaktad›rlar. Leng ve ark. tubal infertilite nedeni
ile laparoskopi yap›lan hastalar›n büyük bir k›sm›nda,
distal fallopian tüplerinden al›nan biopsilerden invitro
ortamlarda çeflitli Klamidya serotipleri üretmeyi
baflarm›fllard›r(12). K. Trachomatis, distal ampullar
53
TJOD Derg 2008; 5: 51- 6
Ercan Y›lmaz ve ark.
segmentte yo¤un olarak bulunur ve kolumnar epiteli
invaze ederek hücre içinde uzun y›llar asemptomatik
olarak kalabilir. Bilinmeyen bir nedenle ki bu
ço¤unlukla uterin enstrumentasyon (HSG, Laparoskopi,
IUD ...) sonucu gerçekleflir, bakteri reaktive olarak
immünopatolojik mekanizmalarla tubal hasara neden
olur. Tubaperitoneal patoloji tan›s›nda laparoskopi ve
HSG kullan›l›r.Laparoskopi en iyi tan› arac› olsada,
günümüzde HSGen yayg›n kullan›lan ve en pratik olan
tan› yöntemidir (6).
üzerinde yapt›klar› di¤er bir çal›flmada PCR tekni¤inin
sensitivitesi %61, spesifitesi ise %100 olarak bildirilmifltir(17).
Domeika ve ark.’n›n yapt›¤› di¤er bir çal›flmada 184 hasta
de¤erlendirilmifl ve PCR tekni¤inin sensitivitesi %85,
spesifitesi %100 olarak bulunmufltur (18).
K. Trahomatis, endoservikste hasta asemptomatik iken
kolonize olabilir. Herhangi bir uterin intrumantasyon
yolu ile ( HSG,Laparoskopi, RIA tak›lmas› esnas›nda,
gibi) assendan yolla üst genital sisteme yay›labilir.
Böyle bir durumda endoservikal PCR örneklemesi
negatif sonuç verse de, hasta K. Trachomatis aç›s›ndan
asemptomatik tafl›y›c› olabilir(6).
K.Trahomatis enfeksiyonuna ba¤l› tubal infertilitesi
olan hastalarda HSG bulgular›n›n tubal hasar›
de¤erlendirmedeki sensitivite ve spesifitesi düflüktür.
Özellikle K.Trahomatise ba¤l› kronik enfeksiyon sonras›
geliflen tubal hasar derecesi ile K.Trahomatis antikorlar›n›n (KAT) titresi aras›nda daha yüksek oranda
pozitif korelasyon saptanm›flt›r(6).
Rota ve ark. 40 infertil ve 20 fertil olmak üzere 60
hasta popülasyonunda endoservikal hücre kültürlerinde
Direct Fluorescence Assay (DFA) ile K. Trachomatis
varl›¤›n› araflt›rm›fllar. 6 asemptomatik infertil hasta
da (% 15) pozitif sonuç elde etmifllerdir(19).
Y›ld›z ve ark. 469 bayan hastan›n kanlar›nda K.
Trahomatis Ig G düzeylerini enzim immünassay (EIA)
yöntemi ile araflt›rm›fl.35 hastan›n kan örne¤inde K.
Trahomatis Ig G antikor düzeyleri pozitif olarak
saptanm›flt›r (%7.46). En yüksek oran infertil hasta
grubunda saptanm›flt›r (%11.17)(12).
Tan ve ark. 1182 asemptomatik bayan›n endoservikal
smear örne¤inde PCR yöntemi ile C. Trachomatis
araflt›r›lm›fl. 48 hasta da (%4.1) K. Trachomatis pozitif
olarak saptam›fllard›r(20).
George ve ark. 63 erkek, 80 kad›n olmak üzere 143
hastada idrar ve endoservikal smear örneklerinde K.
Trachomatisi izole etmeye çal›flm›fllar. PCR yöntemi
ile 24 erkek hastan›n (%38.1) idrar örne¤inde, 22 bayan
hastan›n (%27.5) endoservikal örne¤inde K. Trahomatis
bakterisini pozitif olarak tespit etmifllerdir(21).
Kelver ve ark. 114 infertil hasta grubunda KAT ile
laparoskopik bulgular› karfl›laflt›rm›fllar. 74 hasta da
(%65) pozitif titre bulunmufl, bu hastalar›n 57’sinde(%77),
tubal obstrüksiyon, 3 hastada kornual obstrüsiyon ve 10
hasta da peritubal adezyon saptanm›flt›r(13).
Levidiotou ve ark. 16.834 kad›n, 1035 erkek hastadan
idrar ve endoservikal smear örneklerinde PCR yöntemi
ile K. Trachomatis DNA’s› izole edilmeye çal›fl›lm›fl.
8000 semptomatik kad›ndan 329’unda (%4.1), 8834
asemptomatik kad›ndan 259’unda (%2.9) PCR ile
pozitif sonuçlar al›nm›fl. Semptomatik 1000 erkek
hastadan 116’s›nda (%11.6) PCR ile pozitif sonuçlar
al›n›rken, asemptomatik 35 hastan›n tamam›nda idrar
örneklerinde negatif sonuçlar al›nm›flt›r(15).
Sarov ve ark. 80 infertil hasta grubunda K. Trahomatis
antikor titreleri ile bu hastalar›n HSG’leri aras›nda
korelasyon kurmufllard›r. HSG’ de patoloji saptanan
50 hasta da pozitif K. Trahomatis antikor titreleri elde
edilmifl. Di¤er 30 hastan›n HSG filmlerinde patoloji
saptanmam›fl ve antikor titreleri normal seviyelerde
oldu¤u izlenmifltir(14).
K. Trahomatis enfeksiyonunu saptamada bir çok
tekni¤in birbirine göre alternatifi olsa da, son birkaç
y›lda Klamidya DNA hibridizasyon tekni¤i ( özellikle
PCR) artm›fl sensitivite ve spesifitesi ile ön plana
ç›kmaktad›r (9). PCR yöntemi semptomatik ve asempto-
Robertson ve ark HSG’ de tubal patolojisi olan 48
infertil hasta ve bilateral tubalar› normal olan 77 infertil
hastada EL‹SA yöntemi ile K. Trachomatis antijenlerini
araflt›rm›fllar. Sonuç olarak, tubal patoloji saptanan
grupta olan hastalar›n %73’ün de K. Trachomatis
antijeni pozitif olarak bulunmufltur(22).
matik hastalarda K. Trahomatis enfeksiyon riskini
farkl› derecelerde tespit edebilmektedir(15).
Literatürde yap›lan çal›flmalar incelendi¤i zaman PCR
tekni¤inin di¤er tekniklere göre K.Trahomatis tan›s›nda
belirgin olarak yüksek sensitivite ve spesifitesinin oldu¤u
görülmektedir. Wiesenfeld ve ark.’n›n yapt›¤› çal›flmada
PCR tekni¤inin sensitivitesi %43, spesifitesi ise %100
olarak bulunmufltur(16). Skulnick ve ark.’n›n 993 hasta
TJOD Derg 2008; 5: 51- 6
Valentine ve ark. 1119 infertil hastaya laparoskopi
uygulam›fllar, ayn› zamanda bu hastalar›n tümünde
serolojik olarak K.Trachomatis antikorunu
araflt›rm›fllard›r. Laparoskopik olarak tubal hasar
saptanan hastalarda belirgin olarak K. Trachomatis
antikor düzeyini yüksek titrelerde bulmufllard›r(7).
54
‹nfertil hastalarda endoservikal chlamydia PCR sonuçlar›
J 1985; 7: 717- 25.
Tubal patoloji ve K. Trachomatis antijen aras›nda ki
iliflkiyi aç›klamaya çal›flan Lucisano ve ark. yapt›¤›
bir baflka çal›flma da ise, infertilite tan›s› alan 105
hastaya laparoskopi yap›lm›fl, ayn› zamanda al›nan
doku biopsilerinden hücre kültürlerinde K. Trachomatis
sufllar› izole edilmeye çal›fl›lm›fl. Sonuç olarak; tubal
infertilitesi olan 42 hastadan 13’ünde (%30.9) K.
Trachomatis antijenine saptanm›flt›r (23,24) . K.
5.
World Health Organization. Infections, pregnancies, and
infertility: perspectives on prevention. Fertil and Steril 1987;
47: 964- 8.
6.
Jolande A. Land, Johannes L. H. Evers. Chlamydia infection
and subfertility. Best Practice & Research Clinical Obstetrics
and Gyneacology. 2002 Vol. 16, No. 6, pp. 901- 12,
7.
Valentine AA et al. Tubal gamage in infertile women: prediction
using chlamydia serology. Human Reprod. 2003; 18: 1841-
Trachomatis ve tubal hasar aras›ndaki iliflkiyi KAT
titre düzeyleri ile de¤erlendiren ve 1119 hastan›n dahil
edildi¤i bir çal›flmada; laparoskopide herhangi bir
patoloji saptanamayan hastalar›n serum KAT titresi
1:64’ün alt›nda (negatif sonuç) oldu¤u görülmüflken,
ciddi tubal hasar saptanan olgularda bu de¤erin 1:4096
(pozitif sonuç) oldu¤u saptanm›flt›r(25).
7.
8.
Skulnick M. et al, Use of the polymerase chain reaction for
the detection of Chlamydia trachomatis from endocervical
and urine specimens in an asymptomatic low-prevalence
population of women. Diagn Microbiol Infect Dis. 1994 Dec;
20(4): 195- 201.
9.
Sonuç olarak, literatürde yap›lan çal›flmalar Klamidya
Trachomatis ile tubal patoloji aras›nda ki iliflkiyi ortaya
ç›karmaktad›r. K. Trachomatis hücre içinde ço¤alan
bir bakteri oldu¤u için izolasyonu di¤er enfeksiyon
ajanlar›na göre daha zor ve zahmetlidir. K. Trachomatis
antikorlar›n› identifiye etmek için EIA, ELISA, MIF
gibi yöntemler, etken patojeni izole etmek için hücre
kültürleri kullan›lsa da, son zamanlarda sensitivitesi
ve spesifitesi en yüksek olan ve K. Trachomatis DNA
yap›s›n› ortaya ç›kar›p sero tiplendirmesini sa¤layan
PCR yöntemi, di¤er yöntemlerin yerini alm›flt›r. Biz
bu çal›flmada, HSG de distal tubal patoloji saptanan
Türk infertil hasta popülasyonunda endoservikal K.
Trachomatis varl›¤›n› PCR yöntemi araflt›rd›k.
Ald›¤›m›z sonuçlarla infertil hastalarda C. Trahomatis
PCR sonuçlar›n›n distal tubal hastal›¤› saptamada
sensitivitesi düflük ancak spesifitesi ve pozitif prediktif
de¤erinin yüksek oldu¤u sonucuna vard›k.
Black CM. Current methods of laboratory diagnosis of Chlamydia
trachomatis infections. Clinical Microbiology Reviews. 1997;
10: 160- 84.
10.
Weström L. Incidens, prevalence, trends acute pelvic inflammatory
disease and its consequences in industrialized countries. Am
J of Obstet and Gyneacol 1980; 138: 880- 92.
11.
Honey E, Templeton A. Prevention of pelvic inflammatory
disease by the control of C. Trahomatis infection. Int J Gynecol
Obstet. 2002; 78: 257- 61.
12.
Y›ld›z A, Guner H, Rota S, Gürsoy R, Erdem A. Use of the
polymerase chain reaction for the detection of Chlamydia
trachomatis from endocervical and urine specimens in an
asymptomatic low-prevalence population of women. Gynecol
Obstet Invest. 1990; 29(4): 282- 4.
13.
Kelver ME, Nagamani M. Chlamydial serology in women
with tubal infertility. Int J Fertil. 1989; 34: 42- 5.
14.
Sarov et al. Specific IgG and IgA antibodies to Chlamydia
trachomatis in infertil women. Int J Fertil. 1986; 31: 1937.
15.
Levidiotu S et al. Chlamydia trachomatis infections in Geece:
first prevalance study using nucleic acid amplification tests.
KAYNAKLAR
Eur J Microbiol Infect Dis. 2005; 24: 207- 13.
1.
2.
3.
4.
16.
Gates W, Wasserheit JN. Genital chlamydia infections: Epidemiology
Wiesenfeld, H. C., M. Uhrin, B. W. Dixon, and R. L. Sweet.
and reproductive sequelae. Am J Obstet Gynecol 1991; 164:
Diagnosis of male Chlamydia trachomatis urethritis by polymerase
1771.
chain reaction. Sex Transm Dis, 1994; 21: 268- 71.
17.
Dong ZW, Li Y, Zhang LY, Liu RM. Detection of Chlamydia
Skulnick, M., R. Chua, A. E. Simor, D. E. Low, H. E. Khosid,
trachomatis intrauterin infection using polymerase chain reaction
S. Fraser, E.Lyons, E. A. Legere, and D. A. Kitching. Use of
on chorionic villi. Int J Gynecol Obstet 1998; 61: 29- 32.
the polymerase chain reaction for the detection of Chlamydia
Judson FN. Epidemiology and control of nongonococcal urethritis
trachomatis from endocervical and urine specimens in an
and genital Chlamydia infections: a review. Sex Transm Dis
asymptomatic low-prevalence population of women. Diagn
1981; 8: 117- 26.
Microbiol Infect Dis 1994; 20: 195- 201.
18.
Hull MGR, Glazener CM, Kelly NJ et al. Population study
Domeika, M., M. Bassiri, and P.-A. Mårdh. 1994. Diagnosis
of genital Chlamydia trachomatis infections in asymptomatic
of causes, treatment, and outcome of infertility. British Med
55
TJOD Derg 2008; 5: 51- 6
Ercan Y›lmaz ve ark.
males by testing urine by PCR. J Clin Microbiol 1994, 32:
19.
22.
activity in distal Fallopian tube biopsies of women with obstruc-
Rota S, Yildiz A, Kufltimur S, Akbafl E, Günay A, Güner H.
tivetubal infertility. Human Reprod. 1998; 13: 3121-7.
Sample adequacy in detecting Chlamydia trachomatis. Int J
20.
23.
Robertson JN, Ward ME, Conway D, Caul EO. Chlamydial
Gynecol Obstet. 1995; 51: 225- 8.
and gonococcal antibodies in sera of infertile womwn with
Tan HH, Chan R. Use of polymerase chain reaction on pooled
tubal obstruction. J Clin Pathol. 1987; 40: 377- 83.
cervical swabs to detect Chlamydia trachomatis infections in
24.
female workers in Singapore. Singapore Med J. 2005; 46: 215-8.
21.
Leng Z, Moore DE, Mueller BA. Characterization of ciliary
2350- 2.
Lucisano A, Morandotti G, Marana R, Leone F, Branca G.
Chlamydial genital infections and laparoscopic findings in
George JE etal. Evaluation of Diagnostic Efficacy of PSR
infertil women. Eur J Epidemiol 1992; 8: 645- 9.
Methods for Chlamydia trachomatis Infections in Genital
25.
Akande AV, Hunt LP, Cahill JD, et al. Tubal damage in infertile
Urine Specimens of Symptomatic Men and Women in India.
women: prediction using chlamydia serology. Hum Reprod
Jpn J Infect Dis. 2003; 56: 88- 92.
2003; 18: 9: 1841- 7.
TJOD Derg 2008; 5: 51- 6
56
Download
Random flashcards
Create flashcards