tc yıldız teknik üniversitesi fen bilimleri enstitüsü düzlemsel

advertisement
T.C.
YILDIZ TEKNİK ÜNİVERSİTESİ
FEN BİLİMLERİ ENSTİTÜSÜ
DÜZLEMSEL HOMOTETİK HAREKETLER ALTINDAT.C.
YILDIZ TEKNİK ÜNİVERSİTESİ
FEN BİLİMLERİ ENSTİTÜSÜ
FUSOBACTERIUM NUCLEATUM’UN ENOLAZ ENZİMİNİ KODLAYAN GENİN
KLONLANMASI VE ANALİZİ
SİNEM YAKARSÖNMEZ
DANIŞMANNURTEN BAYRAK
YÜKSEK LİSANS TEZİ
BİYOMÜHENDİSLİK ANABİLİM DALI
BİYOMÜHENDİSLİK PROGRAMI
YÜKSEK LİSANS TEZİ
ELEKTRONİK VE HABERLEŞME MÜHENDİSLİĞİ ANABİLİM DALI
HABERLEŞME PROGRAMI
DANIŞMAN
PROF. DR. DİLEK TURGUT-BALIK
İSTANBUL, 2011DANIŞMAN
DOÇ. DR. SALİM YÜCE
İSTANBUL, 2013
T.C.
YILDIZ TEKNİK ÜNİVERSİTESİ
FEN BİLİMLERİ ENSTİTÜSÜ
FUSOBACTERIUM NUCLEATUM’UN ENOLAZ ENZİMİNİ KODLAYAN GENİN
KLONLANMASI VE ANALİZİ
Sinem YAKARSÖNMEZ tarafından hazırlanan tez çalışması 23.12.2013 tarihinde
aşağıdaki jüri tarafından Yıldız Teknik Üniversitesi Fen Bilimleri Enstitüsü
Biyomühendislik Anabilim Dalı’nda YÜKSEK LİSANS TEZİ olarak kabul edilmiştir.
Tez Danışmanı
Prof. Dr. Dilek TURGUT-BALIK
Yıldız Teknik Üniversitesi
Jüri Üyeleri
Prof. Dr. Dilek TURGUT-BALIK
Yıldız Teknik Üniversitesi
_____________________
Doç. Dr. Erkan ŞAHİNKAYA
İstanbul Medeniyet Üniversitesi
_____________________
Doç. Dr. Nehir ÖZDEMİR ÖZGENTÜRK
Yıldız Teknik Üniversitesi
_____________________
ÖNSÖZ
Laboratuvar ve tez çalışmamda bilgi ve deneyimi ile bana yol gösteren, karşılaştığım
her türlü sorunu ilgi ve sabırla dinleyip çözümlerini esirgemeyen, akademik çalışma
hayatımda ilerleyebilmem için bana her zaman destek olan, kendisinden çok şey
öğrendiğim değerli hocam Prof. Dr. Dilek Turgut-Balık'a,
Tez çalışmasının yürütülmesine destek sağlayan Yıldız Teknik Üniversitesi KimyaMetalurji Dekanlığı'na, Yıldız Teknik Üniversitesi Biyomühendislik Bölümü Başkanlığı'na
ve bölümümdeki tüm hocalarıma,
Tez çalışmasında kullanılan Fusobacterium nucleatum genomik DNA’sını sağlayan Dr.
Mike Wilward ve Dr. Paul R. Cooper’a, The School of Dentistry, University of
Birmingham, Birmingham, United Kingdom,
Tez çalışmasının yürütülmesi ve tamamlanmasında her türlü destek ve katkılarını
esirgemeyen Uzman Ayşegül Erdemir, Belma Nural, Araştırma Görevlisi Ebru Çayır,
Araştırma Görevlisi Emrah Sarıyer, Araştırma Görevlisi Özal Mutlu, Zeynep Büşra Bolat
başta olmak üzere tüm laboratuvar grup arkadaşlarıma,
Yıldız Teknik Üniversitesi, Biyomühendislik Bölümü’nde bulunan diğer yüksek lisans,
doktora öğrencisi arkadaşlarıma,
Hayatım boyunca aldığım kararlarda her zaman yanımda olan ve yüksek lisans eğitimim
boyunca maddi, manevi desteklerini esirgemeyen sevgili aileme çok teşekkür ederim.
Aralık, 2013
Sinem YAKARSÖNMEZ
İÇİNDEKİLER
Sayfa
SİMGE LİSTESİ...................................................................................................................vii
KISALTMA LİSTESİ ..............................................................................................................ix
ŞEKİL LİSTESİ ......................................................................................................................xi
ÇİZELGE LİSTESİ ............................................................................................................... xiii
ÖZET………………………………………………………………………………………………………………………….xiv
ABSTRACT………………………………………………………………………………………………………………....xvi
BÖLÜM 1
GİRİŞ .................................................................................................................................. 1
1.1 Literatür Özeti ............................................................................................. 1
1.1.1 Periodontal Hastalıklar ........................................................................ 1
1.1.1.1 Periodontal Hastalıkların Başlıca Risk Faktörleri ............................ 1
1.1.1.1.1 Dental plak ve oral hijyen............................................................... 2
1.1.1.1.2 Sigara .............................................................................................. 2
1.1.1.1.3 Mikroorganizmalar ......................................................................... 3
1.1.1.1.4 Konak Yanıtı.................................................................................... 4
1.1.1.1.5 Genetik Faktörler ........................................................................... 4
1.1.1.1.6 Psikolojik Faktörler ......................................................................... 5
1.1.1.2 Periodontal Hastalıkların Epidemiyolojisi ...................................... 6
1.1.1.3 Periodontal Hastalıkların Başlıca Tedavi Yöntemleri ..................... 8
1.1.2 Fusobacterium nucleatum ................................................................... 9
1.1.2.1 Periodontal Hastalıklar ile İlişkisi ................................................. 11
1.1.2.1.1 Farklı Bakteriler ile Olan Etkileşimi .............................................. 12
1.1.2.1.2 Konak Hücreler ile Olan Etkileşimi ve İmmün Yanıt Oluşumu ..... 13
1.1.2.2 Diğer Hastalıklarla Olan İlişkisi ..................................................... 14
1.1.2.3 Antibiyotiklere Karşı Duyarlılığı ve Direnci ................................... 16
1.1.3 Enolaz Enziminin Özellikleri ............................................................... 16
1.2 Tezin Amacı ............................................................................................... 18
iv
1.3
Hipotez ...................................................................................................... 18
BÖLÜM 2
MATERYAL VE METOD .................................................................................................... 19
2.1 Materyaller ............................................................................................... 19
2.1.1 Kimyasallar, Enzimler ve Kitler .......................................................... 19
2.1.2 Deneylerde Kullanılan Cihazlar .......................................................... 20
2.1.3 Bakteriyolojik Büyüme Besiyerleri ve Çözeltileri ............................... 21
2.1.4 Stok Çözeltiler ve Tamponlar............................................................. 22
2.1.5 Primerler ............................................................................................ 26
2.1.6 Genomik DNA .................................................................................... 27
2.1.7 Klonlama ve Ekspresyon Vektörleri ................................................... 27
2.1.8 Escherichia coli Soyları ....................................................................... 28
2.2 Metod ....................................................................................................... 28
2.2.1 Fusobacterium nucleatum Enolaz Enzimini Kodlayan Genin Klonlama
Vektörüne (pGEM®-T Easy Vektör Sistemi) Klonlanması .................. 28
2.2.1.1 FnENO Genine Uygun Primerlerin Tasarlanması ......................... 28
2.2.1.2 Polimeraz Zincir Reaksiyonu ........................................................ 29
2.2.1.3 Etidyum Bromür ile Boyanan Agaroz Jel Elektroforezi ................ 29
2.2.1.4 PCR Ürünlerinin Saflaştırılması .................................................... 30
2.2.1.5 FnENO Geninin Klonlanması için Adenin (A) Kuyruğunun
Eklenmesi ..................................................................................... 30
2.2.1.6 Ligasyon Aşaması ......................................................................... 30
2.2.1.7 Kalsiyum Klorür (CaCl2) Muamelesi ile Kompetant E. coli
Hücrelerinin Hazırlanması ............................................................ 31
2.2.1.8 Rekombinant Plazmid DNA’nın E. coli DH5α Hücrelerine
Transformasyonu ......................................................................... 31
2.2.1.9 Rekombinant Plazmid DNA İzolasyonu ........................................ 31
2.2.1.10 Klonlanan genin PCR ile Kontrol Edilmesi .................................... 32
2.2.1.11 DNA Dizi Analizi ............................................................................ 32
2.2.2 Fusobacterium nucleatum Enolaz Enzimini Kodlayan Genin İfade
Vektörüne (pLATE 31) Klonlanması ................................................... 32
2.2.2.1 aLICator LIC Klonlama ve Ekspresyon Kit 3 (C-terminal His-tag)
Sistemine Uygun Primerlerin Tasarlanması ................................. 33
2.2.2.2 FnENO Geninin Klonlama Vektöründen Amplifikasyonu ............. 33
2.2.2.3 PCR ürünlerinin Kristal-Viyole (CV) Jelde Yürütülmesi ve
Saflaştırılması ............................................................................... 34
2.2.2.4 LIC Reaksiyonu ve Rekombinant Plazmid DNA’ların E. coli BL21
(DE3) Hücrelerine Transformasyonu............................................ 35
2.2.2.5 Klonlanan FnENO Geninin Koloni PCR Metodu ile Kontolü ......... 36
2.2.2.6 DNA Dizi Analizi ............................................................................ 36
2.2.3 FnENO Dizisinin Aminoasit Düzeyinde Karşılaştırmalı Analizi ve
FnENO Enziminin Filogenetik Analizi ................................................. 37
2.2.4 Fusobacterium nucleatum Enolaz Enziminin Ekspresyonu ............... 37
2.2.5 Sodyum Dodesil Sülfat Poliakrilamid Jel Elektroforezi ...................... 38
2.2.6 Fusobacterium nucleatum Enolaz Enziminin Saflaştırılması ............. 38
2.2.7 Fusobacterium nucleatum Enolaz Enziminin Molekül Ağırlığı ve Molar
v
Absorblama Katsayısının Değerlerinin Hesaplanması ....................... 39
2.2.8 Saflaştırılmış Fusobacterium nucleatum Enolaz Enziminin
Konsantrasyonun Hesaplanması ....................................................... 39
2.2.9 Fusobacterium nucleatum Enolaz Enziminin Optimum pH ve Spesifik
Aktivite Değerlerinin Belirlenmesi ..................................................... 40
2.2.10 Fusobacterium nucleatum Enolaz Enzimin Termostabilitesinin
Belirlenmesi....................................................................................... 41
2.2.11 Saflaştırılmış Enzimin Kinetik Analizi ................................................. 41
2.2.12 F. nucleatum Enolaz Enziminin Homoloji Modellemesi ve
Süperimpozisyonlarının Yapılması .................................................... 43
BÖLÜM 3
SONUÇLAR VE TARTIŞMA................................................................................................ 45
3.1
Fusobacterium nucleatum Enolaz Enzimini Kodlayan Genin pGEM®-T Easy
Vektör Sistemine Klonlanması .................................................................. 45
3.1.1 Amplifikasyon Primerlerinin Tasarlanması ........................................ 45
3.1.2 FnENO Geninin Amplifikasyonu ve E.coli DH5α Hücrelerine
Transformasyonu ............................................................................... 46
3.1.3 Klonlanan Genin Kontrolü ve Dizi Analizi .......................................... 48
3.2 Fusobacterium nucleatum Enolaz Enzimini Kodlayan Genin pLATE 31
Ekspresyon Vektörüne Klonlanması ......................................................... 50
3.2.1 FnENO Geninin Amplifikasyonu ve E. coli BL21(DE3) Hücrelerine
Transformasyonu ............................................................................... 50
3.2.2 Gen Aktarımının Kontrolü ve Dizi Analizi........................................... 52
3.2.3 FnENO Dizisinin Aminoasit Düzeyinde Karşılaştırmalı Analizi ve
FnENO Enziminin Filogenetik Analizi ................................................. 54
3.2.4 Fusobacterium nucleatum Enolaz Enziminin Ekspresyonu ............... 56
3.2.5 Fusobacterium nucleatum Enolaz Enziminin Saflaştırılması ............. 58
3.2.6 Fusobacterium nucleatum Enolaz Enziminin Optimum pH ve Spesifik
Aktivite Değerinin Belirlenmesi ......................................................... 59
3.2.7 Fusobacterium nucleatum Enolaz Enzim Termostabilitesinin
Belirlenmesi ....................................................................................... 61
3.2.8 Saflaştırılmış FnENO Enziminin Kinetik Analizinin Yapılması ............. 63
3.2.9 FnENO Enziminin Homoloji Modellemesinin Yapılması .................... 65
3.2.10 F. nucleatum Enolazının Süperimpozisyonlarının Yapılması ve RootMean-Square Deviation (RMSD) Değerlerinin Belirlenmesi ............. 72
BÖLÜM 4
DEĞERLENDİRME VE ÖNERİLER ...................................................................................... 74
KAYNAKLAR ..................................................................................................................... 78
ÖZGEÇMİŞ ....................................................................................................................... 85
vi
SİMGE LİSTESİ
A
bç
c
0
C
CaCl2
cm
dH2O
dk
ε
E
ES
g
GC
HCl
H2O
k1
k2
k-1
kb
KCl
kcat
kDa
Km
l
L
Mg
MgCl2
MgSO4
µg
µl
mA
mg
ml
Absorbans
Baz çifti
Protein konsantrasyonu
Santigrat derece
Kalsiyum klorür
Santimetre
Distile su
Dakika
Molar absorblama katsayısı
Enzim
Enzim-substrat kompleksi
Gram
Guanin-sitozin
Hidroklorik asit
Su
Birleşme reaksiyon katsayısı
Ayrışma reaksiyon katsayısı
Tekrar-ayrışma reaksiyon katsayısı
Kilobaz
Potasyum klorür
Dönüşüm katsayısı
KiloDalton
Michaelis-Menten sabiti
Litre
Hücre yol uzunluğu
Magnezyum
Magnezyum klorür
Magnezyum sülfat
Mikrogram
Mikrolitre
Miliamper
Miligram
Mililitre
vii
mm
mM
M
Me
Ms
MW
NaCl
NaH2PO4
ng
nm
OD
pmol
rpm
sn
Tm
U
Ü
VE
Vmax
VT
Milimetre
Milimolar
Molarite
Enzim konsantrasyonu
Son molarite
Molekül ağırlığı
Sodyum klorür
Sodyumdihidrojenfosfat
Nanogram
Nanometre
Optik yoğunluk
Pikomol
Revolutions per munite (Dakika başına devir sayısı)
Saniye
Erime sıcaklığı
Ünite
Ürün
Enzim hacmi
Maksimum hız
Toplam reaksiyon hacmi
viii
KISALTMA LİSTESİ
ABD
ATP
B. forsythus
BSA
CPI
CPITN
CV
dATP
DNA
dNTP
DOPE
E. coli
EDTA
EhENO
EtBr
FISH
FnENO
FNP
F. nucleatum
H. sapiens
HuENO
IL
IPTG
LB
NCBI
ncRNA
Ni-NTA
NMR
PCR
PDB
PEP
2-PGA
P.gingivalis
Amerika Birleşik Devletleri
Adenozin Trifosfat
Bacterioides forsythus
Mavi Seçim Agarı
Toplum Periodontal İndeksi
Tedavi İhtiyaçlarının Toplum Periodontal İndeksi
Kristal Viyole
Deoksiriboadenozintrifosfat
Deoksiribonükleik asit
Deoksiribonükleotidtrifosfat
Discrete Optimized Protein Energy
Escherichia coli
Etilendiamintetraasetik asit
Entrococcus hirae Enolaz
Etidyum Bromür
Floresans in-situ hibridizasyon
Fusobacterium nucleatum Enolaz
Fusobacterium nucleatum polymorphyum
Fusobacterium nucleatum
Homo sapiens
Homo sapiens Enolaz Enzimi
İnterlökin
İzopropil-β -D- tiyogaltopiranosid
Luria-Bertani
National Center for Biotechnology Information
Kodlanmayan Ribonükleik asit
Nikel Nitriloasetik asit
Nükleer Manyetik Rezonans
Polimeraz Zincir Reaksiyonu
Protein Data Bank
Fosfoenolpirüvat
2-fosfo-D-gliserat
Porphyromonas gingivalis
ix
RMSD
RNA
rRNA
RO
SAB
SDS
SDS-PAGE
T. annulata
TAE
TaENO
TEMED
T. forsythia
tRNA
UV
WHO
X-Gal
Root-Mean Square Deviation
Ribonükleik asit
Ribozomal Ribonükleik asit
Bölge Ofisi
Örnek Uygulama Tamponu
Sodyum Dodesil Sülfat
Sodyum Dodesil Sülfat Poliakrilamid Jel Elektroforezi
Theileria annulata
Tris-Asetat-EDTA
Theileria annulata Enolaz Enzimi
Tetrametiletilendiamin
Tannerella forsythia
Taşıyıcı Ribonükleik asit
Ultraviyole
Dünya Sağlık Örgütü
5-bromo-4-kloro-3-indolil-β-D-galaktopiranosid
x
ŞEKİL LİSTESİ
Sayfa
Şekil 1. 1
Şekil 1. 2
Şekil 1. 3
Şekil 1. 4
Şekil 1. 5
Şekil 2. 1
Şekil 2. 2
Şekil 2. 3
Şekil 2. 4
Şekil 2. 5
Şekil 3. 1
Şekil 3. 2
Şekil 3. 3
Şekil 3. 4
Şekil 3. 5
Şekil 3. 6
Şekil 3. 7
Şekil 3. 8
Şekil 3. 9
Şekil 3. 10
Şekil 3. 11
Şekil 3. 12
Şekil 3. 13
Şekil 3. 14
Şekil 3. 15
WHO Bölgesel Ofisi (RO)’nin belirlediği 35-44 yaş yetişkinleri içersinde en
yüksek CPI skorlarının ortalama yüzdeleri. .................................................... 7
Dünya genelindeki 35-44 yaş arası yetişkinlerin diş çürüğü düzeyleri .......... 8
Fusobacterium nucleatum’un elektron mikroskobu görüntüsü .................. 10
FNP ATCC 10953 suşunun genom haritası. .................................................. 11
Glikoliz basamaklarının şematik gösterimi .................................................. 17
pGEM®-T Easy Vektör Sistemi ..................................................................... 27
pLATE 31 ekspresyon vektörü . .................................................................... 28
Enzim katalizlemesi ile substratın ürüne dönüşüm reaksiyonu................... 41
Reaksiyon hızı ve substrat konsantrasyonuna bağlı Michaelis-Menten
denkleminin grafiği. ..................................................................................... 42
Lineweaver-Burk denkleminin grafiği. ........................................................ 43
F. nucleatum üç alt türünün enolaz enzimini kodlayan gen dizilerinin
eşleştirmesi sonucundaki 5’ ucu nükleotid dizisi ......................................... 45
F. nucleatum üç alt türünün enolaz enzimini kodlayan gen dizilerinin
eşleştirmesi sonucundaki 3’ ucu nükleotid dizisi ......................................... 45
PCR ile amplifiye edilen FnENO geninin agaroz jel elektroforez görüntüsü.46
Long PCR Enzim Mix ile oluşan PCR ürününün agaroz jel elektroforezi
görüntüsü ..................................................................................................... 47
pGEM®-T Easy Vektör Sistemi ile yapılan klonlama sonrası
transformasyonda LB-BSA petrilerinde görülen koloniler ........................... 47
Klonlanan genin PCR ile yapılan kontrolünün jel görüntüsü. ...................... 48
Fusobacterium nucleatum subsp. polymorphum ATCC 10953 enolaz geni
(1. sıra) ile bu çalışmada klonlanan genin (2. sıra) dizi analizi ..................... 49
FnENO geninin amplifikasyon sonucu.......................................................... 51
FnENO geninin saflaştırma sonrası agaroz jel elektroforez görüntüsü. ...... 51
Koloni PCR sonrasında elde edilen agaroz jel elektroforez görüntüsü. ....... 53
Alt-klonlama ile FnENO gen dizisine eklenen 6xHis-tag bölgesinin gösterimi .
...................................................................................................................... 54
Enolazın çoklu dizi eşleştirmesi.. .................................................................. 55
FnENO’nun filogenetik ağacı ........................................................................ 55
Hücrelerin 5 saat inkübe edilmesinin ardından elde edilen
ekspresyonsonucu. ...................................................................................... 57
Hücrelerin bir gece boyunca inkübe edilmesinin ardından elde edilen
xi
Şekil 3. 16
Şekil 3. 17
Şekil 3. 18
Şekil 3. 19
Şekil 3. 20
Şekil 3. 21
Şekil 3. 22
Şekil 3. 23
Şekil 3. 24
Şekil 3. 25
Şekil 3. 26
Şekil 3. 27
Şekil 3. 28
Şekil 3. 29
Şekil 3. 30
Şekil 3. 31
ekspresyon sonucu....................................................................................... 57
Saflaştırma sonrası gerçekleştirilen SDS-PAGE görüntüleri. ........................ 59
Ortalama değerlere göre belirlenen pH-absorbans değerleri ..................... 61
FnENO enziminin termostabilite deneyi sonucunda elde edilen absorbans
değerleri ve zaman grafiği ............................................................................ 62
Saflaştırma sonrası elüsyonlardan elde edilen FnENO enziminin SDS-PAGE
görüntüsü. .................................................................................................... 63
FnENO enziminin kararlı hal kinetiği grafiği ................................................. 65
FnENO (2. sıra) ve EhENO (1. sıra) enzimlerinin aminoasit dizilerinin
eşleştirilmesi ................................................................................................ 66
FnENO’nun seçilen en iyi modelinin görüntüsü ........................................... 67
Model FnENO’nun ERRAT programı sonucunun görüntüsü. ....................... 67
Optimizasyon sonrası FnENO modelinin Z-skor sonucu .............................. 68
Optimizasyon sonrası FnENO modelinin enerji düzeyi grafiği ..................... 69
Optimizasyon sonrası FnENO modelinin Ramachandran diyagramı. .......... 69
SOPMA programına göre FnENO model proteinin ikincil yapı sonuçları..... 70
Model proteinin aktif bölgelerinin Q-SiteFinder görüntüsü. ....................... 71
Model proteinin aktif bölgelerinin DoGSiteScorer görüntüsü. .................... 71
FnENO ve EhENO enzimlerinin aminoasit dizilerinin süperimpozisyonu. ... 72
Üç farklı insan enolaz dizileri ile FnENO’nun aminoasit dizilerinin
süperimpozisyonları. .................................................................................... 73
xii
ÇİZELGE LİSTESİ
Sayfa
Çizelge 1. 1
Çizelge 2. 1
Çizelge 2. 2
Çizelge 2. 3
Çizelge 2. 4
Çizelge 2. 5
Çizelge 3. 1
Çizelge 3. 2
Çizelge 3. 3
Çizelge 3. 4
Çizelge 3. 5
Çizelge 3. 6
Çizelge 3. 7
Çizelge 3. 8
F. nucleatum enfeksiyonun primer tanısı............... ………………………………15
FnENO geninin genomik DNA’dan amplifikasyonunda kullanılan PCR
bileşenleri ................................................................................................ 29
Ligasyon Bileşenleri ................................................................................. 30
FnENO geninin rekombinant plazmid DNA’dan amplifikasyonunda
kullanılan PCR Bileşenleri ........................................................................ 34
FnENO gende 5’ ve 3’ yapışkan uçları oluşturmak için gerekli olan
reaksiyon bileşenleri ............................................................................... 35
Koloni PCR Bileşenleri.............................................................................. 36
Ligasyon reaksiyonunun bileşenleri ........................................................ 52
Çoklu tekrarlar sonrasında elde edilen ortalama absorbans değerleri
(ΔA240/dk) .............................................................................................. 60
FnENO enziminin termostabilite deneyi sonucundaki absorbans
değerleri (ΔA240/dk) ............................................................................... 62
Saflaştırma sonrası seçilen elüsyonların 280 nm’deki absorbans değerleri
................................................................................................................. 63
Değişen substrat konsantrasyonlarına göre ölçülen ortalama ΔA240/dk
değerleri .................................................................................................. 64
F. nucleatum enolaz enziminin belirlenen kinetik özellikleri .................. 65
RMSD değerleri ....................................................................................... 73
Farklı türlerdeki enolaz enzimlerinin 2-PGA için kinetik değerlerinin
karşılaştırılması ........................................................................................ 76
xiii
ÖZET
FUSOBACTERIUM NUCLEATUM’UN ENOLAZ ENZİMİNİ KODLAYAN GENİN
KLONLANMASI VE ANALİZİ
Sinem YAKARSÖNMEZ
Biyomühendislik Anabilim Dalı
Yüksek Lisans Tezi
Tez Danışmanı: Prof. Dr. Dilek TURGUT BALIK
Fusobacterium nucleatum insanlarda periodontitis, gingivitis gibi periodontal
hastalıklara neden olmaktadır. Ayrıca F. nucleatum oral mikrobiyomda bulunan yaygın
türlerden biri olup, oral floradaki diğer bakteriler ve konak epitelyal hücreler ile
etkileşmektedir. Fusobacteria’larda antibiyotik duyarlılığının rapor edilmesi, bu türe
karşı alternatif ilaçların geliştirilmesi gerektiğini göstermektedir.
Enolaz F. nucleatum’un glikolitik yolağındaki, 2- fosfogliserik asidin (2-PGA) fosfoenol
pirüvata (PEP) dönüşümü reaksiyonundan sorumlu enzimdir. Bakterinin
metabolizmadaki rolünden dolayı F. nucleatum’un enolaz enzimi bu çalışmada hedef
molekül olarak seçilmiştir. F. nucleatum enolaz enzimi literatürde ilk defa izole edilmiş,
klonlanmış, eksprese edilmiş, kinetik ve yapısal olarak analiz edilmiştir.
F. nucleatum enolazı (FnENO) kodlayan gen ilk olarak pGEM®-T Easy Vektör sistemine
klonlanmıştır. Daha sonra Escherichia coli BL21 (DE3) hücrelerinde enzimin
ekspresyonunun yapılması için pLATE 31 vektörüne alt-klonlaması yapılmıştır. Ni-NTA
agarozu kullanılan affinite kromatografisi ile protein saflaştırılmasını sağlamak için
proteinin C- terminal ucuna 6xHis-tag bölgesi eklenmiştir. Protein saflaştırma
işleminden sonra 46,37 kDa olan proteinin SDS-PAGE analizinde enzimin, % 95’in
üzerindeki yüksek saflıkta elde edildiği gösterilmiştir. Bu enzimin kinetik
karakterizasyonu öncesinde optimum pH ve termostabilite analizleri yapılmıştır. FnENO
xiv
enziminin optimum pH’ı 8,5 olarak bulunmuştur ve spesifik aktivitesi 57,14 U/mg
olarak hesaplanmıştır. Termostabilite analizleri FnENO aktivitesinin 30-60 0C arasında
stabil kaldığını göstermiştir. Kinetik analiz pH 8,5 ve 250C’de yapılmıştır. Saflaştırılmış
FnENO enziminin kinetik parametreleri GraFit 3.0 kullanılarak belirlenmiştir. Kinetik
değerler, 2-PGA substratının kullanılmasıyla Km: 0,4825 mM, Vmax: 0,1587, kcat: 20,38 s-1
and kcat/Km: 4,22 x 104 M-1s-1 olarak elde edilmiştir. Fusobacterium nucleatum enolaz
enziminin homoloji modellemesi Enterococcus hirae enolazının yapısı kalıp alınarak
oluşturulmuş ve muhtemel ilaç hedef bölgeleri tanımlanmıştır. Tüm bu sonuçlar yapıya
dayandırılmış ilaç tasarımı doğrultusunda yeni görüşler ortaya çıkarabilecek ve enolaz,
insandaki Fusobacterium nucleatum enfeksiyonlarını baskılamak için aday olabilecektir.
Anahtar kelimeler: Fusobacterium nucleatum, enolaz, periodontal hastalıklar, kinetik
karakterizasyon, yapıya dayandırılmış ilaç tasarımı.
YILDIZ TEKNİK ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ
xv
ABSTRACT
CLONING AND ANALYSIS OF THE GENE ENCODING ENOLASE ENZYME
FROM FUSOBACTERIUM NUCLEATUM
Sinem YAKARSÖNMEZ
Department of Bioengineering
MSc. Thesis
Adviser: Prof. Dr. Dilek TURGUT-BALIK
Fusobacterium nucleatum is related to periodontal diseases such as gingivitis and
periodontitis in human. It is also one of the prevalent species in the oral microbiome
and interacts with other bacteria in oral flora and host epithelial cells. Antibiotic
susceptibility in Fusobacteria has been reported, so this showed that development of
alternative drugs against this species is required.
Enolase is an enzyme which is responsible from a reaction in glycolytic pathway of F.
nucleatum and converts 2-phosphoglyceric acid (2-PGA) to phosphoenolpyruvate
(PEP). In this study, F. nucleatum enolase was chosen as a target molecule because of
its role in the metabolism of the bacteria. The enzyme was isolated, cloned, expressed
and analysed both kinetically and structuraly, for the first time in the literature.
The gene encoding enolase from F. nucleatum (FnENO) was first cloned into pGEM®-T
Easy Vector system and then sub-cloned into pLATE 31 vector for the expression of
enzyme in Escherichia coli BL21 (DE3) cells. 6xHis-tag region was added to the Cterminal of the protein to enable purification of the protein by affinity
chromotography using Ni-NTA agarose. SDS-PAGE analysis of the 46,37 kDa protein
showed that the enzyme was obtained at high purity, over >% 95, following the protein
purification process. Optimum pH and thermostability analyses were performed prior
to kinetic characterization of the enzyme. It was found that the optimum pH was 8,5
for this enzyme and specific activity was calculated as 57,14 U/mg. Thermostability
analyses showed that FnENO activity remained stable between 30-60 0C. Kinetic
xvi
analysis was performed at pH 8,5 and 250C. Staedy state kinetic parameters of purified
FnENO was determined using GraFit 3.0. Kinetic values were obtained using 2-PGA as
substrate; Km: 0,4825 mM, Vmax: 0,1587, kcat: 20,38 s-1 and kcat/Km: 4,22 x 104 M-1s-1.
Homology modelling of Fusobacterium nucleatum enolase enzyme was built using
Enterococcus hirae enolase structure as template and possible drug target regions
were described. All these results may open new insights towards structure based drug
design studies and enolase may be a candidate molecule to combat Fusobacterium
nucleatum infections in human.
Keywords: Fusobacterium nucleatum, enolase,
characterization, structure based drug design.
periodontal diseases, kinetic
YILDIZ TECHNICAL UNIVERSITY
GRADUATE SCHOOL OF NATURAL AND APPLIED SCIENCES
xvii
BÖLÜM 1
GİRİŞ
1.1
Literatür Özeti
1.1.1 Periodontal Hastalıklar
Periodontal hastalıklar öncelikli olarak bakterilerin neden olduğu dişeti ve dişleri
destekleyen dokuları etkileyen kronik bulaşıcı hastalıklardır. Bu hastalıklardan biri dişeti
iltihabı olan gingivitistir. Gingivitis bağ doku kaybı olmaksızın diş eti inflamasyonunun
oluşmasıdır ve dişeti oluk bölgesinde kanama ya da renk değişimi görülmesi ile
belirlenmektedir. Periodontitis ise diş eti inflamasyonunun, diş kökü yüzeyinden
epitalyal bağlantılardaki uç noktalara kadar yayılması ile meydana gelir. Bu durum bağ
doku ve alveolar kemik kaybına kadar gidebilmektedir [1], [2], [3], [4].
Periodontal hastalıkların oluşmasında pek çok risk faktörü etkili olabilmektedir. Bu
hastalıklarda bu risk faktörlerinin belirlenmesi ve erken tanının yapılması diş kaybının
engellenmesi açısından oldukça önemlidir. Periodontal hastalıkların belirlenmesi ve
tedavisi ile dişlerin korunması ve böylece sindirimin iyi bir şekilde yapılması
sağlanabilmektedir [1].
1.1.1.1 Periodontal Hastalıkların Başlıca Risk Faktörleri
Geçmişte periodontal hastalıkların diş plaklarına sahip ve oral hijyeni eksik olan duyarlı
bireylerde meydana geldiği düşünülmekteydi. Ancak, son zamanlarda spesifik
bakteriyel enfeksiyonlarla birlikte çeşitli risk faktörlerinin de bu hastalıkların
gelişmesinde etken olduğu görülmektedir. Bu risk faktörlerinin anlaşılması,
1
klinisyenlerin periodontal hastalığa duyarlı bireyleri ve tedaviye yönelik hedefleri
belirlemelerini sağlamaktadır [4], [5].
1.1.1.1.1 Dental plak ve oral hijyen
Dental plakların, gingivitisin gelişmesinde temel risk faktörlerinden biri olduğu 1965’te
Löe ve arkadaşları tarafından gösterilmiştir [6]. Buna bağlı olarak oral hijyen seviyesi diş
üzerinde plakların oluşmasında doğrudan etkilidir [2], [4]. Oral hijyen gingivitisin
gelişmesinde doğruda etkiliyken, periodontitis hastalığının gelişmesinde daha az bir
etkisi bulunmaktadır. Dişin yüzey ve orta kısımlarındaki mikrobiyal floranın ekolojisini
etkileyebilmektedir, ancak konak cevabına bir etkisi bulunmamaktadır. Ayrıca; oral
hijyenin dişetinin en alt kısımlarındaki mikrofloraya olan etkisi azdır. Yapılan
çalışmalarda periodontitis gibi dişeti hastalıkların ileri seviyesinin oral hijyen ile çok
fazla ilgisinin olmadığı görülmüştür [4].
Kapsamlı ağız hijyeni programları yetişkinlerde ve çocuklarda dişeti iltihaplarının
önlenmesi ve azaltılması açısından oldukça etkilidir. Ancak; bu programlar periodontal
hastalıkların agresif formlarının önlenmesinde çok fazla etkili olamayabilir [2], [4].
1.1.1.1.2 Sigara
Sigara; içinde bulunan 4.000 'den fazla toksin ile ölüm, kardiyovasküler hastalıklar,
çeşitli kanserler ve çeşitli kronik hastalıklar için önemli bir risk faktörüdür. Ayrıca; sigara
içmek, periodontal hastalıklar ve diş kaybı ile uzun süreden beri ilişkili olmuştur.
Örneğin; akut nekrotizan ülseratif gingivitis ile sigara arasındaki ilişki 1947 yılında rapor
edilmiştir [7].
Araştırmalara göre; ağır ve uzun süreli bir sigara öyküsü bulunanlarda, hafif derecede
sigara içenlere göre daha ciddi doku kayıpları gözlenmektedir. Öyle ki sigara ile
periodontal hastalığın şiddeti arasında bir doz-etki ilişkisi vardır. Genellikle
çalışmalarda, sigara içenlerde içmeyenlere kıyasla diş doku kaybında 2 ila 7 kat
arasında bir artış olduğu gösterilmiştir. Ayrıca bu durum sigara içen genç bireylerde
daha belirgin gözlenmiştir [4].
Periodontal tedavi ise sigara içenlerde içmeyenlere göre daha az başarı gösterme
eğilimindedir. Yapılan çalışmalarda, yumuşak doku aşılama işlemlerinin ve implant
2
prosedürlerinin başarı oranları üzerinde sigaranın olumsuz bir etkisinin olduğunu
gösterilmiştir [5].
1.1.1.1.3 Mikroorganizmalar
Dental biyofilm mikroorganizmaların varlığı periodontal hastalıkların başlamasında ve
ilerlemesinde bir ön koşul oluşturmaktadır. Yapılan çalışmalar bakteri türlerinin
kolonizasyonunun
dişeti
bölgelerindeki
patogenezde
çeşitli
roller
oynadığını
göstermektedir. Ayrıca periodontal doku kayıplarının riskini farklı düzeylerde
arttırabilmektedirler [2],[4].
Ağızda koloni halinde bulunan mikroorganizmalar arasında özellikle Porphyromonas
gingivalis,
Bacteroides forsythus, Actinobacillus actinomycetemcomitans türleri
periodontitis için önemli etiyolojik ajanlardır. Periodontitisin erken başlangıçlı agresif
formları ile ilişkili bakteri türleri arasında Actinobacillus actinomycetemcomitans,
genellikle şiddetli bağ doku kaybı veya hastalığın hızlı ilerlediği görülen kişilerde tespit
edilmiştir. P. gingivalis’in ise kronik periodontitis ile kuvvetli bir biçimde ilişkili
olduğunu gösterilmiştir. Dişeti florasında P. gingivalis ve Bacteroides forsythus’un
varlığı, periodontal doku kaybının riskinde artış ile ilişkilendirilmiştir [2], [5]. Yapılan
çalışmalarda Prevotella intermedia, Fusobacterium nucleatum gibi bakterilerin de
çeşitli popülasyonlarda periodontal hastalıklar için risk oluşturduğu gösterilmiştir [2].
İnsan sitomegalovirüs ve diğer herpesvirüslerin aktif enfeksiyonları; kronik ve agresif
periodontitis, nekrotizan dişeti hastalıklarını içeren yıkıcı periodontal hastalıklarda risk
faktörleri olarak görülmektedir. Bir çalışmada; dişetinde bulunan herpesvirüslerin
periodontopatik bakterilerin bu bölgelerdeki kolonizasyonu ile ilişkili olduğu
bulunmuştur [4].
Periodontal çatlaklarda bulunan bu organizmalar periodontitis ile yakından ilişkilidir ve
supragingival plağın bu organizmalar için önemli bir korunak olduğu belirlenen bulgular
arasındadır. Sıklıkla yapılan profesyonel dişeti temizlemesi, iyi bir ağız bakımı iç
kısımlardaki dişeti mikroflorası için yararlı etki gösterebilmekte ve bu hastalıkları
önleyebilmektedir [4].
3
1.1.1.1.4 Konak Yanıtı
Periodontal
hastalıklardaki
iltihabi
reaksiyon,
mikroorganizmalar
tarafından
gerçekleştirilen mikrobiyal saldırı sonucunda başlamaktadır. Bu mikroorganizmaların
zararlı antijenleri ve toksik etkilerine karşı konakta immün yanıt oluşmaktadır. Ancak;
yeterli olmayan immün yanıt mikrobiyal saldırıların yararına gerçekleşmektedir ve doku
kayıpları oluşabilmektedir. Diğer bir şekilde; hiperaktif immün yanıt sitokinlerin ve
diğer inflamatuar moleküllerin fazla üretilmesine neden olmaktadır ve bunun
sonucunda yavaş ve düzenli olarak periodontal bağ doku kayıpları meydana
gelmektedir [2].
İleri düzeyde periodontitis oluşması durumunda; aşırı aktif ve değişime uğramış
nötrofiller bu hastalıkta gözlemlenen doku yıkımlarından sorumlu olmaktadır [5].
Lokalize juvenil periodontitis hastalarındaki nötrofiller ve monositler; artan bağışıklık,
anormal sinyal iletimi ve depresif kemotaksis gibi fonksiyonel anormallikler
göstermektedirler. Sonuç olarak; sistemik konak immün yanıtındaki bozukluklar
periodontitisin patogenezinde önemli bir rol oynamaktadır [2].
1.1.1.1.5 Genetik Faktörler
Periodontal hastalıkların oluşmasında genetik faktörlerin etkili olduğu, bazı genlerin bu
hastalıkları modifiye ettiği düşünülmektedir. Ayrıca; gen-gen etkileşimleri ve epigenetik
faktörler gibi diğer genetik etkenler periodontal hastalıkların gelişmesinde önemli
olabilmektedir [7].
Periodontitisin artan riski ile ilişkili olduğu gösterilen pek çok gen polimorfizmleri
araştırılmıştır. 1997’de yapılan bir çalışmada, özel muayenehanelerdeki hasta verilerini
kullanarak, polimorfik interlökin-1 (IL-1) gen bölgesinin belirli bir genotipinin şiddetli
periodontitis ile ilişkili olduğunu bulunmuştur. Ancak bu bulgular sadece sigara
içmeyen hastalarda gözlenmiştir. Böylece bu genetik faktörün hastalığın oluşmasında
sigara kadar etkili bir risk faktörü olmadığını gösterebilmektedir. Enfeksiyona karşı
konakçı cevabı düzenleyen IL-1 genotipi ve sigara öyküsü birleşimi hastalar için iyi bir
risk profili sağlayabilmektedir ve sigara-genetik faktör arasındaki etkileşim periodontitis
şiddetini belirlemede bir etken olabilmektedir [4].
4
Tek yumurta ikizleri ile yapılan çalışmalar; konak faktörlerinin etkili olduğu periodontal
hastalıklara yatklınlığı % 50 oranında desteklemektedir [4]. Ayrıca bu çalışmalar kronik
periodontal hastalıklarda genetik faktörlerin bir rolü olduğunu kanıtlamaktadır. Agresif
periodontitisin ailesel agregasyonunun, etkilenen kardeşlerin ve birincil üyelerin % 4050’ ye varan yüzdeleri ile belirli ailelerde yüksek etkinlikte olduğu görülmüştür. Agresif
periodontitisin
altında yatan
sebep
bazı durumlarda
lökositlerin
fonksiyon
bozukluğudur ve bu bozukluğun genetik etkenlerden kaynaklandığı düşünülmektedir
[7].
Periodontal hastalığın ailesel agregasyonu genç bireylerde periodontitiste daha
belirgindir ve böylece hastalığın bu formu, yetişkinlerdeki kronik periodontitise göre
daha güçlü genetik altyapılara sahip olabilir [7]
1.1.1.1.6 Psikolojik Faktörler
Psikolojik faktörlerin yıkıcı periodontal hastalıkların artan risk faktörlerinden biri olduğu
hipotezi uzun süredir desteklenmektedir [2]. Araştırmalar, psikolojik stres altındaki
bireylerdeki kliniksel bağ doku kaybı ve alveol kemik kaybı gelişiminin daha olası
olduğunu göstermektedir [5].
Yapılan bir çalışmada; sigara, B. forsythus ve P. gingivalis gibi önemli risk faktörleini
içeren bir model kullanarak psikolojik stres, sıkıntı gibi ölçümler periodontal
hastalıkların çeşitli parametreleri ile ilişkilendirilmiştir. Bu çalışmanın sonuçlarına göre;
mali gerginlik, sıkıntı ve depresyon gibi bozukluklar kronik periodontitisin önemli risk
göstergeleri oldukları belirlenmiştir [2].
Stres ve diğer psikolojik faktörlere bağlı peiodontal doku kaybı risklerine odaklanılan
araştırmalarda immün sistem ve merkezi sinir sistemi arasındaki etkileşim çalışılmıştır.
Psikolojik stres hücresel bağışıklık cevabını down-regüle edebilmektedir ve sinir,
endokrin ve immün sistemi bağlayan sinyal ağının homeostazı bozabilmektedir [2].
Ayrıca; psikolojik stresin artışıyla immün cevap içerisinde olan IL-6 üretiminde artış
gözlenebilmektedir. Başka bir araştırmada; stresin P. gingivalis enfeksiyonuna karşı
immün yanıt için negatif etki oluşturabileceği düşünülmektedir [5]. Sonuç olarak,
periodontal hastalıkların gelişmesinde psikolojik etkenler risk oluşturabilmektedir ve
tedavi sürecini olumsuz etkileyebilmektedir.
5
1.1.1.2 Periodontal Hastalıkların Epidemiyolojisi
Epidemiyoloji, toplumlardaki sağlık ve hastalık çalışmalarıdır ve bu çalışmalar ülkelerin
çeşitli biyolojik, demografik, çevresel ve yaşam tarzı etkisiyle oluşmaktadır. Periodontal
hastalıkların epidemiyoloji çalışmalarının ön koşulu bu hastalıkların doğru bir şekilde
tanımının yapılmasıdır. Epidemiyolojik çalışmalar; diş eti iltihabını, alvolar kemik
kaybının radyolojik değerlendirmesini, bağ doku düzeyinin belirlenmesini içeren
semptomların geniş bir yelpazesi kullanılarak yapılmıştır [4].
Diş plağı, gingitivis ve periodontitis arasındaki ilişki anlayışı değişmiştir ve bu değişim ile
birlikte periodontal hastalıkların küresel ölçüdeki anlayışı ortaya çıkmıştır. Periodontal
hastalığın ölçümünde ilk büyük metodolojik değişiklik Tedavi İhtiyaçlarının Toplum
Periodontal İndeksi (CPITN)’nin tanıtımı olmuştur. CPITN daha sonra Dünya Sağlık
Örgütü tarafından onaylanmıştır ve ismi Toplum Periodontal İndeksi (CPI) olarak
değiştirilmiştir [8]. Veri sunumu için standart parametreler, en yüksek CPI skoru
tarafından kişilerin yüzdeleri ve CPI skoru ile ortalama şiddet miktarı şunlardır; Skor 0:
sağlıklı periodontal koşullar, skor 1: dişeti kanamaları, skor 2: dişeti kanaması ve diştaşı,
skor 3: sığ periodontal cepler (4-5 mm), skor 4: dip periodontal cepler (≥ 6 mm) [9].
En güncel CPITN/ CPI skorlarının listesi Dünya Sağlık Örgütü (WHO) tarafından
yayınlanmıştır. Buradaki sonuca göre; WHO bölgesel alanlardaki en yüksek skor
üzerinden değerlendirildiğinde CPI skorları 4 olan Kuzey ve Güney Amerika’daki
ortalama prevalansın 35-44 yaş arasındaki yetişkinlerin % 20’si olduğu görülmüştür
(Şekil 1.1). Dahası; WHO, Kuzey ve Güney Amerika’daki benzer yaşlardaki yetişkinlerin
% 40’ının CPI skorunun 3 olduğunu tahmin etmektedir [8], [9].
6
Şekil 1. 1 WHO Bölgesel Ofisi (RO)’nin belirlediği 35-44 yaş yetişkinleri içersinde en
yüksek CPI skorlarının ortalama yüzdeleri. AFRO: Africa RO, AMRO: Amerika RO, EMRO:
Doğu Akdeniz RO, EURO:Avrupa RO, SEARO: Güneydoğu Asya RO, WPRO: Batı Pasifik
RO [8], [9].
Ülkelerin son zamanlardaki periodontal hastalıklara eğilimini belirlemek için Dünya
Sağlık Örgütü (WHO)’nün periodontal veritabanları ve diğer kaynaklar kullanılmıştır. Bu
verilere göre; Almanya’da 1997 ve 2005 yılları arasında, periodontal ceplerinin derinliği
4 mm’den fazla olan 35-44 yaşları arasındaki yetişkinlerin yüzdesi % 46’dan % 73’e
yükselmiştir. Benzer bir yükseliş 65-74 yaşları arasındaki yetişkinlerde de gözlenmiştir.
Macaristan’da da 35-44 yaşları arasındaki yetişkinlerde de bu yüzde de % 18’den %
27’ye varan bir artış görülmüştür. İngiltere’de ise bu gözlemlerin aksine 1988 ve 1998
yılları arasında % 75’ten % 59’a varan bir düşüş belirlenmiştir. Amerika’daki verilere
bakıldığında, periodontal ceplerinin derinliği 4 mm’den fazla olan hastalıkların 19881994 ve 1999-2004 yılları arasındaki prevalansı 35-49 yaş arası yetişkinlerde % 22.2’den
% 11.9’a düşmüştür. 4 mm’den fazla doku kaybı olan hastalıkların prevalansının ise %
25.4’ten % 17.82’e düştüğü gözlenmiştir. Bu yıllar arasında periodontitisin prevalansına
bakıldığında yetişkinlerde benzer düşüşler görülmektedir. Avustralya için bakıldığında
periodontal ceplerinin derinliği 4 mm’den fazla olan hastalıkların 1995-1996 ve 20042006 yılları arasındaki prevalansının yetişkinlerde azaldığı gözlenmiştir [8].
Periodontal hastalıklara ilişkin tüm dünya genelini içeren bilgilere son zamanlarda
rastlanmamaktadır. Bu nedenle genel olarak ağız sağlığı durumuna bakılacak olursa
Dünya Sağlık Örgütü (WHO)’nün 2003 yılında yayınladığı ağız sağlığı raporu
7
bulunmaktadır. Bu raporda bulunan dünya genelindeki 35-44 yaş arası yetişkinlerin diş
çürüğü düzeylerini gösteren harita Şekil 1.2’de verilmiştir. Bu haritaya göre Türkiye
orta düzeyde diş çürüğü prevalansına sahip ülkeler arasındadır [10].
Şekil 1. 2 Dünya genelindeki 35-44 yaş arası yetişkinlerin diş çürüğü düzeyleri [10].
21. yüzyılın ilk 10 yılında küresel popülasyonun periodontal durumu bilinmemektedir.
Ulusal ve bölgesel ağız sağlığı araştırmaları periodontal değerlendirmeleri içermekte ve
çoğunlukla gelişmiş ülkelerde yapılmaktadır. Küçük epidemiyolojik çalışmalar, geniş
ulusal anketler periodontitisi tanımlayan doku kaybını ve periodontal cep derinliğini
içermektedir ve bu çalışmalar popülasyon bazlı araştırmaları standartlaştırmada
kullanılabilmektedir. Böylece ileride toplumlardaki potansiyel periodontal hastalık
seviyesinin daha iyi belirleneceği düşünülmektedir [8].
1.1.1.3 Periodontal Hastalıkların Başlıca Tedavi Yöntemleri
Periodontal tedaviler; diş implantlarının kullanılmasını, dişin düzeltilmesini ve çevre
dokuların desteklenmesini amaçlayarak bu hastalıkların iyileştirilmesini ve önlenmesini
sağlamaktadır [11].
Periodontal hastalıkların oluşmasına neden olan bakteri plağı ve diş taşlarının
çıkarılması tedavinin temelini oluşturur. Buna yönelik diş yüzeyi temizliği ve kök yüzeyi
düzleştirmesi yapılmaktadır. Diş yüzeyinin cilalanması ve parlak bir yüzey oluşturulması
8
ile başlangıçta uygulanan tedaviler tamamlanmaktadır [1]. Bazı durumlarda; bu
işlemlere cerrahi müdahalelerde dahil edilebilmektedir. Bu cerrahi uygulamalarda
rezektif yöntemler kullanılabilmektedir. Rezektif yöntemlerde periodontal cebin
yumuşak doku duvarı çıkartılmaktadır. Ayrıca; cebin sert doku duvarının da çıkarıldığı
osteoplasti-osteoektomi işlemleri de uygulanabilmektedir. Diş doku prosedürleri ise
kök rezeksiyonu, diş hemiseksiyonu ve odontoplastiyi içermektedir. Sonraki aşamada
kemoterapik ajanlar; mikrobiyal patojenleri azaltmak ve etkinliklerini değiştirmek için
kullanılabilmektedir. Ayrıca; lokal ya da sistemik ilaç salımı ile immün yanıtı değiştirmek
için ilaç tedavisi uygulanabilmektedir [11], [12].
Çeşitli biyolojik yöntemler kullanılarak da periodontal dokuların yenilenmesi
sağlanabilmektedir. Kemik defektleri, dişeti çekilmesi gibi durumlarda kemik yenileme
greftleri, kök biyomodifikayonu, yönlendirilmiş doku rejenerasyonu ve bunların
kombinasyonlarını içeren prosedürler uygulanabilmektedir. Ek olarak; dişetinde
büyüme ya da yumuşak doku deformitelerinin düzeltilmesinde periodontal plastik
cerrahi de kullanılabilmektedir. İmplant tedavilerinde ise, cerrahi yöntemlerle dental
implantlar yerleştirilmektedir ve peri-implant hastalıkları önlenmektedir. Son olarak;
prosedürler tamamlandığında günlük ağız hijyeni ve gerekli kontroller ile tedavi devam
ettirilmektedir [11].
1.1.2 Fusobacterium nucleatum
Fusobacterium nucleatum Bacteroidaceae ailesine ait olan Fusobacterium genusunun
bir türüdür [13]. Anaerobik, spor oluşturmayan, hareketsiz, gram negatif çubuklu bir
bakteridir (Şekil 1.3). F. nucleatum, en fazla %6 oranındaki oksijen varlığında
yaşayabildiğinden dolayı aerotoleranslı bakteri olarak tanımlanmıştır [13], [14]. Sağlıklı
veya hastalıklı insanların ağız mikroflorasında doğal olarak bulunmaktadır. Konik uçları
olan çok uzun bir çubuk bakterisi olup, ağız boşluğu içinde bulunan 500 veya daha fazla
organizmanın baskın türlerinden biridir. Oral florada genellikle kommensal bakteriler
bulunmaktadır ancak F. nucleatum’u da içeren bir kısmı bakteri fırsatçı patojendirler
[15].
9
Şekil 1. 3 Fusobacterium nucleatum’un elektron mikroskobu görüntüsü [13].
F. nucleatum beş alt türü içerir: polymorphum, nucleatum, vincentii, Fusiforme ve
animalis [16]. Dental plak içerisinde koloni oluşturan türler arasında bir köprü görevi
görmektedir ve ağız boşluğunda bulunan periodontal patojenlerin çoğu türüyle
koagregasyon oluşturma özelliğine sahiptir [13]. Gram negatif ve gram pozitif türler
arasındaki fiziksel etkileşimi sağlayarak biyofilm kolonizasyonunun oluşmasında
merkezi bir rol oynamaktadır. Oksijeni tolere edemeyen anaerob bakteriler için gerekli
olan indirgeyici koşulların ortaya çıkmasına katkıda bulunmaktadır [16].
Karakteristik lipid bileşenleri ile birlikte glikoz ve pepton fermantasyonunun bir ana
ürünü olarak butirik asit üretimi, bu bakteriyi diğer anaerobik, gram-negatif, spor
oluşturmayan Fusobacterium türlerinden ayırmaktadır. Değişken kalınlıkta bir
mukopolisakkarit kapsüle sahip olması patojenik özelliği açısından önemlidir [13].
F. nucleatum alt türü polymorphum ATCC 10953 (FNP) suşu bu çalışmada kullanılmıştır.
Bu suşun genomik özelliklerinin belirtildiği genom haritası Şekil 1.4’de gösterilmiştir
[16].
10
Şekil 1. 4 FNP ATCC 10953 suşunun genom haritası. Açık kahverengi: hücre prosesi,
koyu mor: hücre yapısı, kırmızı: DNA replikasyonu, mavi: genel metabolizma, açık yeşil:
regülasyon, sarı: transkripsiyon, turuncu: translasyon, açık mavi: transport, pembe:
virulans, siyah: bilinmeyen kısımlar. İç halka (turuncu) 5 kb kayan bir pencere
kullanılarak hesaplanan yüzde GC’yi göstermektedir. Sonraki dairedeki üçgenler
tRNA’lar (kırmızı) ve ncRNA’ların (mavi) yerini ve yönünü göstermektedir. Plazmid
(yeşil) ve faj yerleri (camgöbeği rengi) dış dairede görülmektedir [16].
1.1.2.1 Periodontal Hastalıklar ile İlişkisi
Periodontal hastalıkların patogenezi, dişeti plağındaki mikrobiyota ve konak yanıtı
arasındaki etkileşimi içermektedir. Dental dokuların yıkımı ve inflamasyonu, gramnegatif patojenleri içeren bir mikrobiyal biyofilme duyarlı konak yanıtının sonucunda
oluşmaktadır. Ağız boşluğunda belirlenen 300’den fazla türün arasında; Actinobacillus
actinomycetemcomitans, Bacteroides forsythus, Campylobacter spp., Capnocytophoga
spp., Eikenella corrodens, Fusobacterium nucleatum, Porphyromonas gingivalis,
Prevotella
intermedia’yı
oluşturmaktadır.
Bu
içeren
bakteriler
küçük
bir
potansiyel
grubu
gram-negatif
periodontal
bakteriler
patojenler
olarak
tanımlanmaktadır. Periodontal hastalıklarla ilişkilendirilen bu gram-negatif bakteriler
arasında Fusobacterium nucleatum en ilgi çekici olanlarından biridir [17], [18].
Fusobacterium nucleatum dişeti plağında çok fazla bulunan bir anaeorob bakteri
türüdür. Kommensal olma özelliğiyle sağlıklı periodontal bölgelerden izole edilebilen ve
11
aynı zamanda bu hastalıklara neden olabilen fırsatçı bir patojendir. Periodontal
ceplerde ve periapikal lezyonlarda artan oranlarda bulunmaktadır [19].
F. nucleatum, toksik etkileri bulunan değişken sülfür bileşenleri, bütrik ve propiyonik
asit üretebilmektedir. Ayrıca lenfositleri aktive edebilmekte ve oral epitelyal hücreler,
eritrositler, fibroblastlar, lemfositler, polimorfonükleer lökositler, kollajen IV ve laminin
ile adhezyon oluşturabilmektedir. Patojenler ile epitalyal yüzeyde ve dişte kolonize
olan kommensalların etkileşiminde kolonizer köprü olarak bulunmaktadır. Bu bakteri;
hücresel hasarın oluşmasına ve konak içerisinde patojenlerin dağılımına öncülük
etmektedir [17], [20].
1.1.2.1.1 Farklı Bakteriler ile Olan Etkileşimi
F. nucleatum, ağız boşluğundaki mikrobiyal ekolojide önemli bir rol oynamaktadır.
Farklı bakteri türleri ile fiziksel etkileşime geçerek koagregasyon oluşturabilmektedir ve
bu etkileşim rastgele olmamakla birlikte diğer bakteriye spesifik olarak bağlanmaktadır.
F. nucleatum; Streptococci gibi erken kolonizerler arasında anahtar bir role sahiptir ve
doğal dental plak içerisinde özellikle zorunlu anaeorob bakteriler ile etkileşim
içerisindedir. Bu etkileşim anaerob bakterilerin karışık kültürler içerisinde büyümesini
sağlamaktadır [21], [22].
Yapılan bir çalışmada periodontal hastalıklarda etkisi bulunan Peptostreptococcus
micros ile F. nucleatum arasındaki etkileşim incelenmiştir. Peptostreptococcus
micros’un fibril benzeri yapılarının F. nucleatum ile etkileşmesiyle koagregasyon
oluşturduğu görülmüştür. Bu bulgunun bakteriyel kolonizasyon ve periodontal
patogenezisin gelişmesinde önemli bir etkisi olduğu düşünülmektedir [23].
F. nucleatum’un erken kolonizer olan Streptococcus, Actinomyces, Veillonella,
Selenomonas türleri ve P. gingivalis gibi periodontopatojenler ile koagregasyon
yapabildiği rapor edilmiştir [24]. Erken kolonizerler dişin ince zar kısmına tutunurlar,
diğer erken kolonizerler ve F. nucleatum ile koagregasyon oluşturmaktadırlar. Ayrıca;
Selenomonas
flueggi
gibi
geç
kolonizerler
ve
Eubacterium,
Actinobacillus,
Capnocytophaga, Treponema türleri yalnızca F. nucleatum ile etkileşime girmektedirler
[13].
12
In vitro ortamda F. nucleatum, patogenezis ve biyofilm oluşumu sırasında Tannerella
forsythia ile sinerji oluşturmaktadır. In vivo ortamda F. nucleatum ve T. forsythia dişeti
biyofilmlerinde ara tabakalara hükmetmektedirler. Yapılan bir çalışmada bu iki
bakterinin konak inflamatuar yanıtını indüklediği ve alveolar kemik kaybında sinerjik
etkileri olduğu görülmüştür [25].
F. nucleatum; ya doğrudan ya da diğer virülans bakterilerin plak oluşturmasına aracı
olarak insanlarda periodontal hastalıkların gelişmesinde önemli bir etken olmaktadır
[18].
1.1.2.1.2 Konak Hücreler ile Olan Etkileşimi ve İmmün Yanıt Oluşumu
Bakterilerin etkileşimi ve bu etkileşim sonucunda epitelyumun çevrelenmesi bakteriyal
enfeksiyonların oluşmasında kritik faktörlerdendir. Epitelyal hücreler ile etkileşim
içinde olmaları koloni oluşturmalarını kolaylaştırmaktadır. Bakterilerin istilası, dokuların
iç kısımlarına yayılmasına neden olur ve immün yanıtın oluşmasını sağlamaktadır [18].
F. nucleatum’un çeşitli virülans fenotipleri belirlenmiştir ve adhesif organizma olarak
tanımlanmaktadır. Çünkü; epitelyal ve endotelyal hücreler, polimorfonükleer lökositler,
monositler, eritrositler, fibroblastlar ve HeLa hücreleri gibi çeşitli konak memeli
hücrelerine bağlanmaktadır. F. nucleatum’un adhesin moleküllerinin belirlenmesi
patogenezin anlaşılması açısında önemlidir. Lektin benzeri ve lektin benzeri olmayan
adhesinler bu bakteride bulunmaktadır ve porin proteini, çeşitli polipeptidler F.
nucleatumda bulunan uygun adhesinlerdir [26].
F. nucleatum epitel hücrelerini istila etmektedir ve bu hücreler içerisinde yaşayıp,
çoğalabilmektedir. Epitel hücreleri içerisinde matriks metalloproteinazların üretilmesini
indükleyerek periodontitiste bağ doku yıkımına neden olabilmektedirler. Ayrıca;
enfekte olan epitel hücrelerini ortadan kaldırmak ve enfeksiyonun daha fazla
yayılmasını
engellemek
amacıyla
bu
bakteri
hücreleri
apoptozise
yönlendirebilmektedir. Periferik kanın mononükleer ve polimorfonükleer hücrelerinin
apoptozu indüklemektedir ve periapikal fibroblastların da büyümesini önlemektedir.
Bu durum, iltihaplı dişetlerinde yaygın hücre hasarlarına neden olmaktadır [19].
F. nucleatum epitel hücrelerini çeşitli sitokinleri, inflamutar molekülleri üretmesi için
tetiklemektedir. Epitel hücreler monositler ve nötrofilleri etkileyen kemokinler gibi
13
antimikrobiyal peptitleri üretmektedir [17], [19].Yapılan bir çalışmada; F. nucleatum’un
insan dişeti epitel hücrelerini kapladığı ve bu hücrelerden yüksek oranda interlökin-8
(IL-8) salımını indüklediği görülmüştür. IL-8 düşük molekül ağırlığına sahip bir
proinflamatuar kemokindir ve nötrofilleri aktive etmektedirler. Nötrofillerin dişeti
oluğuna göçünü düzenleyerek immün yanıtı tetiklemektedirler [18].
Çalışmalar F. nucleatum hücre duvarı ekstraktının, immün yanıt ile ilişkili genlerin
ifadesinde önemli değişikliklere neden olduğunu göstermektedir. CCL20, S100A7,
Skalp, IL1F9, CXCL5, C3, IL32, SAA1, SPRR2C ve CXCL1’i içeren 20 genin up-regüle
olmasına neden olmaktadır. Bu 20 genin içerisinde 14’ü sitokinler, doğal bağışıklık ve
inflamatuar markırları, antimikrobiyaller, proteaz inhibitörleridir. Bunlardan ikisi
epitelyal tabakanın yapısı ile ilişkilidir. Down-regüle olan genler ise genellikle hücre
döngüsünü düzenleyen genleri içermektedir. Bu şekilde F. nucleatum’un immün yanıtın
oluşmasında önemli etkileri bulunmaktadır [17].
1.1.2.2 Diğer Hastalıklarla Olan İlişkisi
F. nucleatum, insan oral floranın bir üyesidir ve periodontal hastalıkların bir ajandır.
Oral anaerobların, aynı zamanda ekstra-oral enfeksiyonlara da büyük olasılıkla neden
olduğu görülmektedir. Fusobacterium nucleatum akciğer ve beyin apseleri,
osteomiyelitis, pelvik enfeksiyonları ve sinüzit gibi insan klinik enfeksiyonlarında
gözlenebilen yaygın bir anaeorobtur [27], [28].
Yapılan bir çalışmada; geçmişte çeşitli periodontal hastalıkları bulunan sağlıklı bir
kadında F. nucleatum’dan kaynaklı göz çevresinde septik trombofilebitis ve kavernöz
sinüsün geliştiği görülmüştür. Büyük olasılıkla fusobacterial enfeksiyon periodontal
bölgede ortaya çıkmıştır, kavernöz sinüs ve çevresinde bu bakteri sekonder olarak
yayılmıştır [29].
Son zamanlarda; ağırlıklı olarak erken doğum olgularında belirlenen rahim içi
enfeksiyonlarda F. nucleatum en yaygın türlerden biridir. Oluşan bu enfeksiyonun ağız
boşluğunda bulunan F. nucleatum’dan kaynaklandığı düşünülmektedir. Bu ölü doğum
süreci durumunda; bu bakteri vajinal ve rektal florada değil annenin ağız boşluğunda
bulunmuştur. Yapılan hayvan çalışmalarında ağızda bulunan F. nucleatum’un hamile
farenin plesantasında lokal inflamasyona sebep olan spesifik kolonizasyon oluşturduğu
14
görülmüştür [30]. Ayrıca; F. nucleatum enfeksiyonunun başka hastalıklarla da
ilişkilendirilerek primer tanısı yapılabilmektedir (Çizelge 1. 1) [27].
Çizelge 1. 1 F. nucleatum enfeksiyonun primer tanısı [27]
Primer Tanı
(Örnek sayısı = 39)
Belirlenen Sayı
(% Yüzde)
Teşhis Olmayan
12 (31)
Karın İçi Hastalıkları
10 (26)
Hematolojik Bozukluklar
7 (18)
Diğer1
3 (8)
Deri ve Yumuşak Doku
2 (5)
Solid Organ Malignitesi
2 (5)
Genitoüriner
2 (5)
1.Bir kemik ve eklem enfeksiyonu, bir trombüs ilişkili enfeksiyonu, bir akciğer enfeksiyonunu
içermektedir.
F. nucleatum’un neden olduğu beyin, karaciğer, eklem ve kalp kapakçığını içeren
metastatik enfeksiyonlar nadir de olsa görülmektedir [27]. Ayrıca; son zamanlarda bu
bakterinin kolorektal kanser ile ilişkili olduğu belirlenmiştir. Yapılan çalışmada donmuş
bir tümör örneğinden Fusobacterium izolatı elde edilmiştir ve bu izolat bilinen bir
bağırsak mukoza izolatı ile yüksek seviyede dizi benzerliği göstermiştir. Böylece F.
nucleatum’un invaziv olduğu doğrulanmıştır [31]. Bir diğer çalışmada; Fusobacterium
dizileri karsinomlarda belirlenmiştir ve 95 karsinom/normal DNA çiftlerinin kuantitif
PCR ve 16S rRNA dizi analizi ile doğrulanmıştır. Ayrıca; floresans in-situ hibridizasyon
(FISH) yöntemi kullanılarak Fusobacteria kolorektal kanser tümörlerinin içerisinde
görüntülenmiştir. Bu bulgular kolorektal kanserin mikrobiyotasında değişiklikler
olduğunu ortaya koymaktadır ve Fusobacteria’nın bu anlamda incelenmesi gerektiğini
göstermektedir [32].
15
1.1.2.3 Antibiyotiklere Karşı Duyarlılığı ve Direnci
Fusobacteria en sık kullanılan antibiyotiklerin birçoğunu duyarlıdır. Yapılan
çalışmalarda; Fusobacteria’ların tüm izolatlarının metronidazol ve kalindamisine duyarlı
olduğu
görülmüştür.
Ancak
neomisin,
eritromisin,
amoksisilin,
amfisillin,
fenoksimetilpenisilin ve vankomisine duyarlılığı azalmakta ya da dirençli olabilmektedir
[13], [27].
F. nucleatum’un genellikle bir penisilinaz olduğu bilinen β-laktamazı ürettiği
bilinmektedir. Oral kommensal flora içerisinde F. nucleatum’un β-laktamazı üreten
formları da üretmeyen formları da bulunabilmektedir. β-laktamazı üreten türlerinin
oluşmasının artması ile birlikte penisiline olan direnç de artmaktadır. Bir çalışmada; F.
nucleatum izolatlarının penisiline karşı %9 oranında dirençli olduğu görülmüştür. Erken
çocukluk döneminde yapılan başka bir çalışmada ise; yaşamın ilk yılındaki
antimikrobiyal ajan kullanımına ve yaşın ilerlemesine göre penisiline dirençli F.
nucleatum taşıyıcılık oranının arttığı belirlenmiştir [27], [33].
Tetrasikline dirençli F. nucleatum türleri periodontal hastalığı olan hastalardan alınan
dişeti plağı örneklerinde bulunmuştur. Bu bakteri, tetrasikline karşı ribozomların
korunmasını sağlayan proteinleri kodlayan tetM genini taşımaktadır. Bu gen
konjugasyon yoluyla diğer bakterilere aktarılabilmektedir ve böylece tetrasiklin
kullanımının artmasıyla bu antibiyotiğe karşı olan direnç artabilmektedir. Ayrıca; bu
genin bulunduğu bölgede başka antibiyotik direnç genleri bulunabildiğinden bu genin
transferi ile diğer antibiyotiklere karşı da direnç gelişebilmektedir [13].
Ampisilin dirençli F. nucleatum izolatlarıyla D sınıfı β-laktamaz sentezi antimikrobiyal
tedaviyi karmaşık hale getirebilmektedir. Çünkü; bu enzimlerin sentezi ile birçok βlaktam antibiyoiklerine karşı direnç oluşabilmektedir [14].
1.1.3 Enolaz Enziminin Özellikleri
Enolaz, pirüvatın sentezlenmesi reaksiyonlarında etkili olan metabolik bir enzimdir ve
2-fosfo-D-gliseratın (2-PGA) fosfoenolpirüvata (PEP) dehidrasyonunu katalizleyen bir
metalloenzimdir. Fosfopirüvat hidrataz olarak da bilinen enolaz, Lohman ve Mayerhof
tarafından 1934 yılında keşfedilmiştir. Bu enzimin ters reaksiyonu ise glukoneogenesis
sırasında meydana gelmektedir ve PEP’in 2-PGA’ya hidrasyonunu katalize etmektedir
16
[34], [35], [36]. Enolaz enzimi glikolitik yolağın bir basamağında görev aldığından
ökaryotik ve prokaryotik hücreler için oldukça önemlidir (Şekil 1.5) [36].
Şekil 1. 5 Glikoliz basamaklarının şematik gösterimi; HK: Hekzokinaz, FGİ: Fosfoglikoz
izomeraz, FFK: Fosfofruktokinaz, TFİ: Trioz fosfoizomeraz, GAFDH: Gliseraldehit
fosfodehidrogenaz, FGK: Fosfogliserat kinaz, FGM: Fosfogliserat mutaz, PK: Pirüvat
kinaz [37]
Enolaz iki değerlikli katyon metaller ile aktifleşen bir enzimdir ve magnezyum doğal
kofaktör olarak görev görmektedir. Mg+2 varlığında enolaz en yüksek aktivitesini
göstermektedir [34], [38]. Arkeabakterilerden memelilere kadar olan bütün canlılarda
enolaz bulunmaktadır ve gen dizisi yüksek ölçüde korunmuştur [35]. Bu enzim
memelilerde dimer olarak bulunurken, prokaryotlarda dimer ya da oktomer şeklinde
olabilmektedir [38].
Ökaryotik ve prokaryotik hücrelerin enolazlarının fibronektin bağlayıcı aktiviteye sahip
olduğu ve patogeneziste rol oynadığı düşünülmektedir [39]. Yapılan bir çalışmada;
enolazın fibronektine yüksek affinite gösterdiği görülmüştür. Ayrıca; bu protein yeni bir
adhezin olarak endotelyal hücrelerin istilası için bakteriyal adhezyona katkıda
17
bulunmaktadır. Bu sonuçlara göre; enolaz, konakçı hücreler ile bakteriyel etkileşimleri
kolaylaştırarak patogenezde önemli bir molekül olabileceğini göstermektedir [40]. Ek
olarak yapılan hayvan çalışmalarında patojenik bakterilerden kaynaklı enolazın
immunojenik protein olarak rol aldığı görülmüştür [39].
Enolazın patolojik rolü hücrenin yüzeyinde eksprese olması ile bağlantılıdır ve birçok
patojen bakteride plazminojen bağlayabilme özelliğine sahiptir. Fibrinolitik sistemin
ilerleyen aktivasyonu, enfekte konağın bariyerlerine bakterilerin nüfuz etmesini
tetiklemektir. Enolaz gibi çeşitli bakteriyel moleküllerin plazminojen reseptör olarak
görev gördüğü rapor edilmiştir [41]. Enolazın α ve β izorformlarının her ikisi de
plazminojen bağlayıcı proteindirler ve plazminojen ile etkileşimleri sırasında C-terminal
lizin rezidüleri gerektirmektedirler. Enolaz burada plazminojen ile C-terminal lizin
rezidülerinden bağlanan hücre yüzeyi proteinlerini temsil etmektedir [42]. Çoğu
ökaryotik ve prokaryotik hücrelerde bu proteinin hücre yüzeyinde eksprese edilmesiyle
plazminojen reseptörü olarak görev alırlar ve kanser metastazı ile hücre göçünü
tetiklemektedirler [35].
1.2
Tezin Amacı
Tez çalışmasının amacı; periodontal hastalıklara karşı geliştirilebilecek olan alternatif
tedavi yöntemlerinde Fusobacterium nucleatum enolaz enziminin hedef molekül olarak
çalışılabilmesi için; bu enzimi kodlayan gen bölgesinin klonlanması, ifadesinin
yapılması, aktif enzimin yüksek saflıkta üretilmesi, kinetik karakterizasyonunun
yapılması ve enzimin homoloji modellemesi yapılarak potansiyel ilaç hedef bölgelerinin
belirlenmesidir.
1.3
Hipotez
F. nucleatum enolaz enziminin hedeflenerek glikolitik yolağın inhibe edilmesi ile bu
bakterinin neden olduğu enfeksiyonların baskılanabileceği düşünülmektedir. Bu
nedenle enzimin, yüksek oranda saf ve aktif olarak üretilmesi ile yeni ilaçların
geliştirilmesi için ileride yapılabilecek olan inhibitör çalışmalarında önemli bir hedef
olarak kullanılabileceği öngörülmektedir.
18
BÖLÜM 2
MATERYAL VE METOD
2.1
Materyaller
2.1.1 Kimyasallar, Enzimler ve Kitler
DNA’nın replikasyonu için yapılan polimeraz zincir reaksiyonlarında (PCR) Thermo
Scientific (ABD) marka Long PCR Enzim Mix ve Fermantas (Litvanya) marka Pfu DNA
Polimeraz ile birlikte tamponları kullanılmıştır. Ayrıca Fermantas (Litvanya) tarafından
üretilen Taq Polimeraz enzimi, tamponu ve MgCl2 çözeltisi kullanılmıştır. Genin
pGEM®-T Easy Vektör sistemine klonlanması sırasında kullanılan T4 DNA Ligaz enzim ve
tamponlar Promega (ABD)’dan sağlanmıştır.
DNA izolasyonu Promega (ABD) tarafından üretilen Wizard Plus SV Minipreps DNA
Saflaştırma sistemi ile yapılmıştır. PCR sonrası elde edilen ürünlerin saflaştırılması için
kullanılan Wizard SV Gel ve PCR Clean-up sistem Promega (ABD) ve DNA QIAprep
Miniprep kiti QIAGEN (Almanya)’den temin edilmiştir.
Klonlama vektörü olarak kullanılan pGEM®-T Easy Vektör Sistemi Promega (ABD)’dan
sağlanmıştır. Protein ekspresyonu için kullanılan pLATE 31 vektörü ve bu vektörün
içerisinde bulunduğu aLICator LIC Cloning ve Expression Kit 3 (C-terminal His-tag)
sistemi Thermo Scientific (ABD)’ten temin edilmiştir. Ekspresyon sonrasında elde
edilen proteinlerin saflaştırılması için QIAGEN (Almanya) tarafından üretilen Nikelnitriloasetik asit (Ni-NTA) agaroz kullanılmıştır.
19
Agaroz jel elektroforezinde DNA’nın baz çifti (bç) uzunluğunu belirlemek için Fermantas
(Litvanya) tarafından üretilen O’GeneRuler DNA Ladder Mix kullanılmıştır. Bu markırda
bulunan DNA bantlarının baz çifti uzunlukları sırasıyla; 10000, 8000, 6000, 5000, 4000,
3500, 3000, 2500, 2000, 1500, 1200, 1000, 900, 800, 700, 600, 500, 400, 300, 200,
100’dür. DNA’nın konsantrasyonunun belirlenmesi için kullanılan Lambda DNA/Hind III
markır Amersham Pharmacia Biotech (ABD)’ten temin edilmiştir. Bu markırda bulunan
DNA bantlarının baz çifti uzunlukları ve konsantrasyonları sırasıyla 23130
(238.4ng/0.5μg), 9416 (97.1ng/0.5μg), 6557 (67.6ng/0.5μg), 4361 (45ng/0.5μg), 2322
(23.9ng/0.5μg), 2027 (20.9ng/0.5μg), 564 (5.8ng/0.5μg), 125 (1.3ng/0.5μg)’dir.
Sodyum dodesil sülfat poliakrilamid jel elektroforezinde (SDS-PAGE) proteinlerin
molekül ağırlığını belirlemek için ise Thermo Scientific (ABD) tarafından üretilen
Spectra Multicolor Broad Range Protein Ladder kullanılmıştır. Bu markırda bulunan
protein bantlarının molekül ağırlıkları sırasıyla; 260, 140, 100, 70, 50, 40, 35, 25, 15, 10
kDA’dur.
Deneyler sırasında kullanılan diğer kimyasal maddeler BDH, Sigma, Promega, Roche
tarafından temin edilmiştir.
2.1.2 Deneylerde Kullanılan Cihazlar

Su Banyosu- Kerman

Mikrosantrifüj- Sigma

UV Visible Spektrofotometre- Thermo Scientific

Dikey Elektroforez Sistem- BioRad

Soğutmalı Santrifüj- Sigma

Termal Döndürücü- Eppendorf

Vorteks- Heidolph

Çalkalamalı İnkübatör- GFL

pH Metre- CyberScan

Ultrasonikasyon- Bandelin

Mikrodalga Fırın- Beko

Etüv- Binder

Yatay Elektroforez Sistem- BioRad

Jel Görüntüleme Sistemi- BioRad
20

Bilgisayar- LG

Çalkalayıcı – Labnet

Buz Makinası- Optic Ivymen System

Distile Su Cihazı- GFL

-80 0C Buzdolabı- Heto

+4 0C Buzdolabı- Beko

-20 0C Buzdolabı- Beko

Otoklav- Systec

Hassas Terazi- Ohaus
2.1.3 Bakteriyolojik Büyüme Besiyerleri ve Çözeltileri
LB (Luria-Bertani) Sıvı Besiyeri
Maya Ekstraktı
5 g/l
Tripton
10 g/l
NaCl
10 g/l
LB (Luria-Bertani) Agar
Maya Ekstraktı
5 g/l
Tripton
10 g/l
NaCl
10 g/l
Agar
15 g/l
SOC Mediyum (25 ml)
Maya Ekstraktı
0,5 g
Tripton
0,125 g
1 M NaCl
0,25 ml
1 M KCl
0,0625 ml
2 M Mg+2 Çözeltisi
0,25 ml
2 M Glikoz
0,25 ml
21
2 M Mg+2 çözeltisi ve 2 M glikoz çözeltisi filtre ile sterilize edilerek hazırlanır. Maya
ekstraktı, tripton, 1 M NaCl, 1 M KCl karışımına 24,1875 ml su eklenerek tamamlanır ve
otoklavlanarak sterilize edilir. Otoklavlandıktan sonra oda sıcaklığına ulaştığında 2 M
Mg+2 çözeltisi ve 2 M glikoz çözeltisi gerekli miktarlarda karışıma eklenerek 25 ml SOC
mediyum hazırlanır.
BSA (Mavi Seçim Agarı)
Amfisilin (stok 100 mg/ml)
100 µl
X-Gal (stok 20 mg/ml)
200 µl
IPTG (stok 20 mg/ml)
160 µl
Otoklavlanarak sterilize edilmiş olan 100 ml LB agara yukarıdaki kimyasal maddeler
eklenerek hazırlanır.
2.1.4 Stok Çözeltiler ve Tamponlar
Amfisilin (100 mg/ml)
Stok amfisilin 1 ml’ye 100 mg olacak şekilde sulandırılır ve filtre ile sterilize edilir.
50X TAE (Tris-Asetat-EDTA) Tampon Çözeltisi (100 ml)
Trizma Base
24,2 g
Asetik Asit
5,71 ml
1 M EDTA (pH 8.0)
50 ml
Elde edilen karışım dH2O ile 100 ml’ye tamamlanır. Çalışma sırasında dH2O ile 1 X
TAE’ye seyreltilir.
CaCl2 Çözeltisi (100 ml)
100 mM CaCl₂.2H₂O
1,4702 g
5 mM
0,10165 g
MgCl₂.6H₂O
5 mM Tris HCl (pH: 7.6)
0,5 ml
Stok 1 M Tris-HCl (pH: 7.6)’den 0,5 ml eklenerek son konsantrasyon 5 mM olacak
şekilde ayarlanır. Elde edilen çözelti 121 0C’de otoklavlanarak sterilize edilir.
22
Mg⁺² Stok Çözeltisi (100 ml)
MgCl₂.6H₂O
20,33 g
MgSO₄.7H₂O
24,65 g
Yukarıda verilen kimyasal maddelere distile su eklenerek 100 ml’ye tamamlanır. Filtre
ile sterilize edilir ve +4 0C’deki dolaba kaldırılır.
EtBr-Agaroz Jel için Örnek Uygulama Tamponu (EtBr-SAB) (10 ml)
Sükroz
4g
2 M Tris-HCl
0,5 ml
0.5 M EDTA
2 ml
Bromfenol mavisi
4 mg
Kristal Viyole (CV) Çözeltisi
Distile su ile 5 mg/ml stok çözeltisi hazırlanır ve karanlık ortamda saklanır.
Kristal Viyole Jel İçin Örnek Uygulama Tamponu (CV-SAB)
Gliserol
500 µl/ml
1X TAE
500 µl/ml
Kristal viyole (stok 5 mg/ml)
10 µl/ml
Hazırlanan tampon karanlık ortamda saklanır.
X-GAL (5-bromo-4-kloro-3-indolil-β-D-galaktopiranosid)
0,02 g X-Gal, 1 ml N,N-dimetilformamid (DMF) içersinde çözülerek 20 mg/ml stok X-Gal
çözeltisi hazırlanır ve filtre ile sterilize edilir.
IPTG (İzopropil-β -D- tiyogaltopiranosid)
100 mM 1,5 ml stok IPTG için 35,74 mg IPTG tartılır ve distile su ile 1,5 ml’ye
tamamlanır. Filtre ile sterilize edilir.
23
% 30 Akrilamid/Bis Çalışma Çözeltisi (30 ml)
Akrilamid
8,7 g
N, N'-Metilen-Bis-Akrilamid
0,3 g
%10 Amonyum Persülfat Çözeltisi
30 mg amonyum persülfat üzerine 300 µl distile su eklenerak hazırlanmaktadır.
SDS-PAGE Ayırma Jeli (%12)
dH2O
3,35 ml
1,5 M Tris-HCl (pH 8,8)
2,5 ml
%10 SDS
100 µl
%30 Akrilamid/Bis
4 ml
% 10 Amonyum Persülfat
75 µl
TEMED
15 µl
SDS-PAGE Yükleme Jeli (%4)
dH2O
3,05 ml
0,5 M Tris-HCl (pH 6,8)
1,25 ml
%10 SDS
50 µl
%30 Akrilamid/Bis
0,65 ml
% 10 Amonyum Persülfat
30 µl
TEMED
6 µl
SDS-PAGE Örnek Uygulama Tamponu (SDS-SAB) (10 ml)
% 10 SDS
1g
0.5 M Tris HCl (pH: 6.8)
0.6 g
% 5 Gliserol
0.5 ml
24
% 25 β-Merkaptoetanol
% 0.05 Bromfenol mavisi
0.25 ml
0.005 g
5X SDS-PAGE Tank Tamponu
0,025 M Trizma Base
15 g/l
0,192 M Glisin
72 g/l
% 0,1 SDS
5 g/l
Distile su ile 1X’e seyreltilerek kullanılır.
Protein Boyama Çözeltisi
% 0,1 Coomassie Brillant Mavisi
% 40 Metanol
% 10 Glasiyal Asetik Asit
Boya Uzaklaştırıcı Çözelti
% 5 Metanol
% 7 Asetik Asit
Boya uzaklaştırıcı çözelti kullanıldıktan sonra aktif karbon ile muamele edilir. Çözelti,
filtre kağıdı ya da peçete ile süzülerek tekrar kullanılabilir.
Lizis Tamponu (1 l) (pH : 8.0)
50 mM NaH2PO4
6,00 g NaH2PO4 (MW 119,99 g/mol)
300 mM NaCl
17,54 g NaCl (MW 58,44 g/mol)
10 mM imidazol
0,68 g imidazol (MW 68,08 g/mol)
Yıkama Tamponu (1 l) (pH : 8.0)
50 mM NaH2PO4
6,00 g NaH2PO4 (MW 119,99 g/mol)
300 mM NaCl
17,54 g NaCl (MW 58,44 g/mol)
20 mM imidazol
1.36 g imidazol (MW 68.08 g/mol)
25
Elüsyon Tamponu (1 l) (pH : 8.0)
50 mM NaH2PO4
6,00 g NaH2PO4 (MW 119,99 g/mol)
300 mM NaCl
17,54 g NaCl (MW 58,44 g/mol)
250 mM imidazol
17 g imidazol (MW 68.08 g/mol)
Fusobacterium nucleatum Enolaz (FnENO) Enzimi Aktivite Ölçümü İçin Tampon
Çözeltisi
50 mM Tris HCl (pH :6,5 ; pH :7,0 ; pH :7,5 ; pH :8,0 ; pH :8,5 ; pH :9,0 ; pH :9,5)
1,5 mM MgCl2
Fusobacterium nucleatum Enolaz (FnENO) Enzimi Aktivite Ölçümü İçin Substrat
Çözeltisi
1,5 mM 2-PGA
2.1.5 Primerler
Fusobacterium nucleatum’un enolaz (FnENO) enzimini kodlayan genin vektörlere
klonlanması için 4 farklı primer kullanılmıştır.
FnENO1: 5’-ATGACAGGTATAGTAGAAGTAATTGG-3’
GC Yüzdesi: %35
Tm: 58,5 0C
FnENO2: 5’- TTTTTTWATRTTATARAAAACATC-3’
GC Yüzdesi: %10
Tm:47,3 0C
FnENO LIC F: 5’-AGAAGGAGATATAACTATGACAGGTATAGTAGAAG-3’
GC Yüzdesi: %34
Tm: 60 0C
FnENO LIC R: 5’-GTGGTGGTGATGGTGATGGCCTTTTTTTATATTATAAAAAACATC -3’
GC Yüzdesi: %33
Tm: 64 0C
Tasarlanan primerler Iontek ve Biogen firmasından sağlanmıştır. Bu primerler
polimeraz zincir reaksiyonunda (PCR) ve DNA dizileme sırasında kullanılmıştır. DNA
dizileme işlemi hizmet alımı ile Biogen ve Iontek tarafından yapılmıştır.
26
2.1.6 Genomik DNA
Fusobacterium nucleatum genomik DNA’sı; Dr. Mike Wilward ve Dr. Paul R. Cooper
tarafından The School of Dentistry, University of Birmingham, Birmingham, United
Kingdom’dan temin edilmiştir.
2.1.7 Klonlama ve Ekspresyon Vektörleri
pGEM®-T Easy Vektör Sistemi, her iki ucunda da 3’ terminal timidin bölgeleri bulunan
lineer bir vektördür. Bu sayede kendi üzerine kapanması engellenmektedir ve 3’
terminal bölgelerine uyumlu kuyruğa sahip olan genlerin ligasyon etkinliğini
arttırmaktadır (Şekil 2.1). pGEM®-T Easy Vektör Sistemi, Promega (ABD)’dan
sağlanmıştır [43].
Şekil 2. 1 pGEM®-T Easy Vektör Sistemi [43]
pLATE 31 ekspresyon vektörünün C- terminal bölgesinde, proteinin saflaştırılması
sırasında kolon ile affinitesini sağlayacak olan 6xHis-tag dizisi bulunmaktadır. Ayrıca;
gen ile vektörün ligasyonunu sağlayan yapışkan uç bölgeleri ve IPTG indüklemesi ile
transkripsiyonu sağlayacak olan T7 promotör bölgesi içermektedir (Şekil 2.2). PCR için
gerekli primerler bu yapışkan uç bölgelerine göre tasarlanmaktadır. pLATE 31
ekspresyon vektörü Thermo Scientific (ABD)’ten temin edilmiştir [44].
27
Şekil 2. 2 pLATE 31 ekspresyon vektörü [44].
2.1.8 Escherichia coli Soyları
DH5α: {F- endAI hsdRJ7 (r-, mit) supE44 thi-J ArecAl gyrA96 relAI deoR Δ(lacZYA-argF)U169 480dlacZAM15}
BL21 (DE3): fhuA2 [lon] ompT gal (λ DE3) [dcm] ∆hsdS
2.2
Metod
2.2.1 Fusobacterium nucleatum Enolaz Enzimini Kodlayan Genin Klonlama
Vektörüne (pGEM®-T Easy Vektör Sistemi) Klonlanması
2.2.1.1 FnENO Genine Uygun Primerlerin Tasarlanması
Klonlama vektörüne enolaz enzimini kodlayan genin klonlanabilmesi için bu gen dizinin
genomik DNA’dan amplifiye edilmesi gerekmektedir. Genomik DNA’nın Fusobacterium
nucleatum’un hangi suşundan elde edildiği bilinmediğinden National Center for
Bıotechnology Information (NCBI)’da bulunan 3 farklı suşun enolaz geninin nükleotid
dizileri eşleştirilmiştir [45]. Bu diziler referans alınarak 5’ primeri ve 3’ dejenere primeri
tasarlanmıştır.
28
2.2.1.2 Polimeraz Zincir Reaksiyonu
Polimeraz zincir reaksiyonu Long PCR enzim mix, Taq DNA polimeraz ve Pfu DNA
polimeraz kullanılarak yapılmıştır (Çizelge 2.1)
Çizelge 2. 1 FnENO geninin genomik DNA’dan amplifikasyonunda kullanılan PCR
bileşenleri
Bileşenler
Taq DNA
Polimeraz
Long PCR enzim
Mix
Pfu DNA
Polimeraz
Tampon
5 µl
5 µl
5 µl
10 mM dNTP mix
5 µl
5 µl
5 µl
25 mM MgCl2
3 µl
-
-
5’primer, stok 20 pmol/ µl
2,5 µl
2,5 µl
2,5 µl
3’primer stok 20 pmol/ µl
2,5 µl
2,5 µl
2,5 µl
dH2O
30 µl
33 µl
33 µl
Kalıp DNA
1 µl
1 µl
1 µl
Enzim
1 µl
1 µl
1 µl
Polimeraz zincir reaksiyon koşulları; 95 0C’de 5 dk yapılan bir ön denatürasyon
sonrasında sırasıyla 94 0C’de 1,5 dk, 44 0C’de 2 dk, 72 0C’de 2 dk 45 döngü olacak
şekildedir. Son olarak 72 0C’de 10 dk son uzama basamağı bulunmaktadır.
2.2.1.3 Etidyum Bromür ile Boyanan Agaroz Jel Elektroforezi
Elektroforez için %1’lik agaroz içeren 1 x TAE kaynatılmıştır. Oda sıcaklığında hazırlanan
jel karıştırılarak soğutulmuştur. Soğutulmuş jele 5 µl etidyum bromür eklenmiştir ve
karıştırılmıştır. Jel tepsisi hazırlanmış ve taraklar yerleştirilmiştir. Hazırlanan tepsiye jel
dökülmüştür ve katılaşana kadar beklenmiştir. Taraklar çıkarıldıktan sonra DNA’nın
belirlenmesi için 7 µl dH2O, 2 µl EtBr için sab, 1 µl DNA karışımı hazırlanarak
oluşturulan kuyucuklara koyulmuştur. 40-50 mA’de yaklaşık 1-1.5 saat elektroforez
yapılmıştır. Jelde oluşan DNA bantları 254-312 nm dalga boyunda ultraviyole
transilluminatöründe görüntülenmiştir [46].
29
2.2.1.4 PCR Ürünlerinin Saflaştırılması
Elde edilen PCR ürünleri Wizard® SV Gel and PCR Clean-Up System (Promega)
kullanılarak saflaştırılmıştır [47].
2.2.1.5 FnENO Geninin Klonlanması için Adenin (A) Kuyruğunun Eklenmesi
FnENO geninin pGEM®-T Easy vektör sistemine aktarılması için amplifikasyonu yapılan
genin 5´ ve 3´ ucuna protokole göre adenin kuyruğu eklenmiştir. Adenin kuyruğu
ekleme reaksiyonu aşağıda gösterilmiştir:
10x Taq Tamponu
1 µl
MgCl2
0,8 µl
dATP (10mM)
3,2 µl
PCR ürünü
4 µl
Taq DNA Polimeraz
1 µl (stok ; 2,5 U/µl)
Hazırlanan bileşenler 70 °C’de 30 dakika bekletilmiştir. Elde edilen karışım ligasyonda
istenilen miktarda direkt olarak kullanılmıştır.
2.2.1.6 Ligasyon Aşaması
Adenin kuyruğu eklenmiş olan gen T4 DNA Ligaz enzimi kullanılarak pGEM®-T Easy
Vektör sistemine ligasyonu yapılmıştır (Çizelge 2. 2).
Çizelge 2. 2 Ligasyon Bileşenleri
Bileşenler
Miktar
2 x Rapid Ligasyon Tamponu
5 µl
pGEM®-T Easy Vektör
1 µl
PCR Ürünü
2,5 µl
T4 DNA Ligaz (3 ünite/ µl)
1 µl
Steril dH2O
0,5 µl
Toplam
10 µl
30
Belirlenen ligasyon bileşenleri ile reaksiyon 4 0C’de 16 saatte gerçekleştirilmiştir [43].
2.2.1.7 Kalsiyum Klorür (CaCl2) Muamelesi ile Kompetant E. coli Hücrelerinin
Hazırlanması
E. coli DH5α hücreleri -80 0C’deki stoktan alınarak LB Agar’lı petrilere sürme ekimi
yapılmıştır. Bu petriden tek koloni seçilerek 5 ml’lik LB sıvı besiyerine ekimi yapılmıştır.
37 0C’de 180 devirde bir gece boyunca bu kültür inkübe edilmiştir. Elde edilen
kültürden 500 µl alınarak 50 ml’lik LB sıvı besiyerine aktarılmıştır. 37 0C’de 180 devirde
UV spektrofotometrede 600 nm’de ölçülen optik yoğunluk (OD) absorbans değeri 0.30.4 olana kadar inkübe edilmiştir. İstenen değere ulaştıktan sonra kültür 4 0C’de 5000
rpm’de 5 dk santrifüj edilmiştir. Süpernatant atılmıştır ve pelletler 25 ml CaCl2
çözeltisinde çözdürülmüştür. Hücreler 30 dk buzda bekletilmiştir ve tekrar 40C’de 5000
rpm’de 5 dk santrifüj edilmiştir. Süpernatant atılıp pelletler 1 ml CaCl2 çözeltisinde
çözdürülmüştür. 2 saat buzda bekletilen hücreler ya direk olarak transformasyonda
kullanılmıştır [46].
2.2.1.8 Rekombinant Plazmid DNA’nın E. coli DH5α Hücrelerine Transformasyonu
Ligasyon sonrası elde edilen örneklere 200 µl kompetant hücre eklenmiştir. Hücreler
30 dk buzda bekletilmiştir ve 42 0C’de su banyosunda 90 sn bekletilmiştir. Sonraki
aşamada 2 dk buz içerisinde bekletilmiştir. Örneklerin üzerine 800 µl SOC mediyum
eklendikten sonra 30 dk 37 0C’de etüvde bekletilmiştir. Hazırlanan hücrelerin amfisilin
eklenmiş olan BSA’lı petrilere ekimi yapılmıştır. Bir gece boyunca 37 0C’de etüvde
bekletilmiştir [46]. Bu inkübasyondan sonra BSA petrilerinden koloni seçimi yapılmıştır.
BSA petrilerinin içinde bulunan X-Gal bileşeni transforme olmuş hücrelerin beyaz,
transforme olmamış hücrelerin mavi renkte görülmesini sağlamaktadır. Bu hücrelerden
beyaz ve açık mavi renkte olan hücreler seçilmiştir ve DNA izolasyonu yapılmıştır.
2.2.1.9 Rekombinant Plazmid DNA İzolasyonu
Seçilen koloni kürdan ile alınıp amfisilin içeren 5 ml’lik besiyerinde bir gece boyunca
37°C’de inkübe edilmiştir. 1,4 ml kültür alınarak 1,5 ml’lik mikrosantrifüj tüpüne alınır
ve DNA QIAprep Miniprep kiti kullanılarak izole edilmiştir. Alınan kültür santrifüj
31
edilerek süpernatant atılmıştır. Pellet 250 µl P1 tamponu ile çözdürülmüştür. Üzerine
250 µl P2 tamponu eklenerek karıştırılmıştır. 350 µl N3 tamponu eklenerek tekrar
karıştırılmıştır. Elde edilen çözelti 13000 rpm’de 10 dk santrifüjlenmiştir ve süpernatant
spin kolona aktarılmıştır. 13000 rpm’de 1 dk santifüjlenmiştir. Altta kalan kısmı
dökülerek 0,5 ml PB tamponu eklenmiştir ve 13000 rpm’de 1 dk santrifüj edilmiştir.
0,75 ml PE tamponu eklenmiştir ve tekrar aynı koşullarda santrifüj edilmiştir. Son
olarak 50 µl EB tamponu eklenmiştir ve 13000 rpm’de 1 dk santifüj edilmiştir. Bu
şekilde rekombinant plazmid DNA’lar hücreden izole edilmiştir [48].
2.2.1.10 Klonlanan genin PCR ile Kontrol Edilmesi
İzole edilen rekombinant plazmid DNA’lar Long Enzim Mix kullanırak yapılan polimeraz
zincir reaksiyonu ile kontrol edilmiştir. PCR, 2.2.1.2’de belirtilen şekilde yapılmıştır. Elde
edilen PCR ürünleri EtBr’lü agaroz jelde yürütülerek görüntülenmiştir.
2.2.1.11 DNA Dizi Analizi
Klonlanan geni içeren plasmid DNA’ların dizi analizi Iontek (Türkiye) firmasına
yaptırılmıştır.
2.2.2 Fusobacterium nucleatum Enolaz Enzimini Kodlayan Genin İfade Vektörüne
(pLATE 31) Klonlanması
aLICator LIC Klonlama ve Ekspresyon Kit 3 (C-terminal His-tag) sistemi; ligasyon ve
restriksiyon enzim kesimi basamakları olmadan genin ekspresyon vektörüne
klonlanmasını sağlar. Genin amplifikasyonunda kullanılacak olan primerler kitte
önerildiği gibi pLATE 31 vektörüne uygun olacak şekilde tasarlanır. Bu primerler
kullanılarak yapılan reaksiyon sonrasında PCR ürünleri saflaştırılır. Saflaştırılan PCR
ürünleri kitte belirtilen konsantrasyon değerlerine uygun olacak şekilde ligasyon
işleminde kullanılır. LIC sisteminde bulunan T4 DNA polimeraz, 5'→3' polimeraz
aktivitesi ve 3'→5' ekzonükleaz aktivitesi ile PCR ürünlerinin pLATE 31 vektörü ile
birleşmesini sağlayacak yapışkan uçlar oluşturur. Sistemindeki ligasyon protokolüne
göre vektör ve genin birleşmesi sağlanır. Son olarak elde edilen rekombinant DNA’lar E.
coli BL21(DE3) hücrelerine transforme edilir [44].
32
2.2.2.1 aLICator LIC Klonlama ve Ekspresyon Kit 3 (C-terminal His-tag) Sistemine
Uygun Primerlerin Tasarlanması
Primer tasarımı, pLATE 31 vektörüne spesifik olacak şekilde kit sisteminde önerildiği
gibi yapılmıştır [44]. Klonlacak gene komplementer olan nükleotid dizileri önerilen
primerlerin 3’ ucuna eklenerek tasarlanmıştır.
Kit kitapçığında bulunan 5’ primer dizaynı:
5'- AGAAGGAGATATAACTATG– ilgili gene spesifik dizi 3'
Kit kitapçığında bulunan 3’ primer dizaynı:
5'-GTGGTGGTGATGGTGATGGCC– ilgili gene spesifik dizi 3'
2.2.2.2 FnENO Geninin Klonlama Vektöründen Amplifikasyonu
Kalıp DNA olarak kullanılacak olan FnENO genini içeren pGEM®-T Easy vektör
sisteminin bulunduğu E. coli suşu -80 0C’deki buzdolabından alınmıştır ve bu hücrelerin
amfisilin içeren LB Agar’lı petrilere sürme ekimi yapılmıştır. Bir gece boyunca
bekletildikten sonra tek koloni seçimi yapılarak 5 ml olarak hazırlanmış 5 µl amfisilin
içeren LB sıvı besiyerine ekimi yapılmıştır. Bu hücre kültürü, 37 0C’de 180 rpm’de gece
boyunca çalkalamalı inkübatöre bırakılmıştır. Daha sonra kültürden alınan 1,4 ml
örnekten 2.2.1.9’dakine benzer şekilde Wizard® Plus SV Minipreps DNA Saflaştırma
sistem kullanılarak rekombinant plazmid DNA’lar elde edilmiştir [49].
FnENO geninin PCR ile amplifikasyonunda Long PCR Enzim Mix, Pfu DNA polimeraz, Taq
DNA polimeraz şeklinde 3 farklı enzim kullanılmıştır (Çizelge 2. 3).
Polimeraz zincir reaksiyonu 2.2.1.2’de verilen koşullarla aynı olacak şekilde
uygulanmıştır. Elde edilen PCR ürünleri agaroz jel elektroforezinde yürütülürek genin
amplifiye edilip edilmediği kontrol edilmiştir.
33
Çizelge 2. 3 FnENO geninin rekombinant plazmid DNA’dan amplifikasyonunda
kullanılan PCR Bileşenleri
Bileşenler
Taq DNA
Polimeraz
Long PCR enzim
Mix
Pfu DNA
Polimeraz
Tampon
5 µl
5 µl
5 µl
10 mM dNTP mix
5 µl
5 µl
5 µl
25 mM MgCl2
3 µl
-
-
2,5 µl
2,5 µl
2,5 µl
2,5 µl
2,5 µl
2,5 µl
30 µl
33 µl
33 µl
Kalıp DNA
1 µl
1 µl
1 µl
Enzim
1 µl
1 µl
1 µl
5’primer, stok 20 pmol/ µl
3’primer, stok 20 pmol/ µl
dH2O
2.2.2.3 PCR ürünlerinin Kristal-Viyole (CV) Jelde Yürütülmesi ve Saflaştırılması
FnENO geninin Taq DNA polimeraz ile yapılan amplifikasyonlarından sonra kristalviyole (CV) jel elektroforezi yapılmış ve saflaştırılmıştır.
CV jel hazırlamak için 1X TAE tamponuna %1’lik olacak şekilde agaroz eklenerek
mikrodalga fırında kaynatılmıştır. Elde edilen karışıma son konsantrasyonu 2 µg/ml
olacak şekilde kristal-viyole eklenerek CV jel elde edilmiştir. Jel tepsisine kuyucukları
oluşturacak tarak konulduktan sonra hazırlanan jel dökülmüştür. Jel donduktan sonra
tanka yerleştirilmiştir ve taraklar çıkarılmıştır. PCR örneklerinin içine 2 µl CV için sab
eklenerek kuyucuklara konulmuştur. 30 mA’de yaklaşık 10 dakika elektroforezde
yürütülmüştür [46]. Beyaz ışık altında görüntülenen jelde uygun bant belirlenerek
neşter ile kesilmiştir. Wizard® SV Gel ve PCR Clean-up sistem protokolü uygulanarak
DNA örnekleri saflaştırılmıştır [47].
34
2.2.2.4 LIC Reaksiyonu ve Rekombinant Plazmid DNA’ların E. coli BL21 (DE3)
Hücrelerine Transformasyonu
Ligasyon için aLICator LIC Klonlama ve Ekspresyon Kit 3 (C-terminal His-tag) sistemi
protokolüne göre FnENO geninin nükleotid dizisi uzunluğuna göre ligasyonda
kullanılacak miktar hesaplanmıştır. Çizelge 2.4’de belirtilen oranlarda reaksiyon
karışımı hazırlanarak gende 5’ ve 3’ yapışkan uçlarının oluşması sağlanmıştır.
Çizelge 2. 4 FnENO gende 5’ ve 3’ yapışkan uçları oluşturmak için gerekli olan reaksiyon
bileşenleri
Bileşenler
Hacim
5 x LIC Tampon
2 µl
Saflaştırılmış PCR Ürünü
0,1 pmol
Su
9 µl’ye kadar kullanılabilir
T4 DNA Polimeraz, 1u/µl
1 µl
Toplam
10 µl
Bileşenler sırasıyla eklendikten sonra 3-5 saniye santrifüj edilmiştir ve 5 dakikayı
geçmeyecek şekilde oda sıcaklığında bekletilmiştir. Beklemeden sonra 0,6 µl 0,5 M
EDTA ve 1 µl pLATE 31 vektör (60 ng, 0,02 pmol DNA) eklenmiştir. Tekrar 3-5 saniye
santrifüj edilmiştir. Son olarak 2 saati geçmeyecek şekilde oda sıcaklığında
bekletilmiştir. Elde edilen rekombinant plazmid DNA’lar E. coli BL21(DE3) hücrelerine
transforme edilmiştir.
Transformasyon için kompetant E. coli BL21(DE3) hücreleri 2.2.1.7’deki protokole göre
hazırlanmıştır. Ancak transformasyon aşamasında iki farklı protokol uygulanmıştır.
Birincisinde 12 µl rekombinant DNA örneğine 200 µl kompetant hücre eklenmiştir.
İkincisinde 6 µl rekombinant DNA örneğine 50 µl kompetant hücre eklenmiştir. İkinci
transformasyon protokolü aLICator LIC Klonlama ve Ekspresyon Kit 3 (C-terminal Histag) sisteminde belirtilen değerlere uygun olcak şekilde hesaplanarak yapılmıştır [44].
Hücre ekimi basamağından sonraki aşamalar 2.2.1.8’de verilen şekilde uygulanmıştır.
Farklı olarak ikinci transformasyonda 300 µl SOC besiyeri kullanılmıştır. Son olarak elde
edilen hücreler amfisilin içeren LB agar’lı petrilere ekim yapılmıştır ve 37 0C’de gece
boyunca etüvde bekletilmiştir.
35
2.2.2.5 Klonlanan FnENO Geninin Koloni PCR Metodu ile Kontolü
Petrilerde görülen beyaz koloniler alınıp koloni PCR yapılarak transformasyonun
kontrolü yapılmıştır. Öncelikle koloniler seçilerek 5 ml’lik amfisilinli LB sıvı besiyerinde
kültürleri yapılmıştır. Bu kültürlerden 100 µl alınarak 13000 rpm’de 7 dk santrifüj
edilmiştir. Süpernatantları atıldıktan sonra 100 µl dH2O’da çözülmüştür. 10 dk kaynar
suda bu örnekler bekletilmiştir. Tekrar 13000 rpm’de 15 dk santrifüj edilmiştir ve
hazırlanan örneklerden 10 µl çekilerek PCR yapılmıştır (Çizelge 2. 5).
Çizelge 2. 5 Koloni PCR Bileşenleri
Bileşenler
Örnekler
Kontrol
Tampon
5 µl
5 µl
10 mM dNTP mix
5 µl
5 µl
25 mM MgCl2
3 µl
3 µl
FnENO LIC F (5’primer) stok 20 pmol/ µl
2,5 µl
2,5 µl
FnENO LIC R (3’primer) stok 20 pmol/ µl
2,5 µl
2,5 µl
dH2O
21 µl
30 µl
Kalıp DNA
10 µl
1 µl
Enzim
1 µl
1 µl
Koloni PCR yapılırken Bölüm 2.2.2.2’de verilen PCR koşulları kullanılmıştır. Kontrolü
yapılan hücrelerin gliserol ile -80 0C’de stoku hazırlanmıştır.
2.2.2.6 DNA Dizi Analizi
Pozitif kolonilerin hücre kültürüne Wizard® Plus SV Minipreps DNA Saflaştırma sistem
protokolü uygulanarak rekombinant plazmid DNA’lar elde edilmiştir [49]. aLICator LIC
Klonlama ve Ekspresyon Kit 3 (C-terminal His-tag) sisteminde bulunan 5’ ve 3’ primerler
kullanılarak dizi analizi Biogen (Türkiye) firması tarafından yapılmıştır.
36
2.2.3 FnENO Dizisinin Aminoasit Düzeyinde Karşılaştırmalı Analizi ve FnENO
Enziminin Filogenetik Analizi
F. nucleatum’un konağı olan Homo sapiens’in beyin ve kas hücrelerinin enolaz
proteinin aminoasit dizileri NCBI veri tabanından bulunmuştur [45]. Bu diziler FnENO
dizisi ile aminoasit düzeyinde Clustal W2 programı kullanılarak eşleştirilmiştir [50].
Laboratuvarımızda bir apikompleksan paraziti olan Theileria annulata’nın enolaz enzimi
ile daha önceden yapılan karşılaştırmalı analizde katalitik rezidüler belirlenmiştir [51].
Bu tez çalışmasında da Theileria annulata enolaz enziminin aminoasit dizisi referans
alınarak yapılan eşleştirme sonucunda katalitik rezidüler belirlenmiştir.
Karşılaştırma sonucundan bu türlerin filogenetik ağacı MEGA 5.3 programında
neighbour- joining (N-J) yöntemiyle oluşturulmuştur [52].
2.2.4 Fusobacterium nucleatum Enolaz Enziminin Ekspresyonu
-80 0C’de stoktaki FnENO genini içeren pLATE 31 ekspresyon vektörünü bulunduran
E.coli BL21(DE3) hücreleri ve negatif kontrol amaçlı FnENO genini içermeyen E.coli
BL21(DE3) hücreleri alınarak LB agara sürme ekimi yapılmıştır. Ertesi gün bu hücrelerin
5 ml’lik LB sıvı besiyerine kültürü yapılmıştır. FnENO genini içeren hücrelerin ekiminde
besiyerlerine amfisilin eklenmiştir.
Her iki örnek için de 100 ml LB sıvı besiyeri hazırlanmıştır. Hazırlanan besiyerlerinden
birine 100 µl amfisilin eklenmiştir ve 1 ml FnENO genini içeren E.coli BL21(DE3)
hücreleri bu besiyerine ekilmiştir. Diğer besiyerine de 1 ml FnENO genini içeren E.coli
BL21(DE3) hücreler ekilmiştir. Bu örnekler 37 0C’de 180 devirde inkübe edilmiştir. UV
spektrofotometrede 600 nm’de optik yoğunluk (OD) ölçümü alınmıştır. OD600 değeri
0,6 olduğunda hücreler, uygun konsantrasyonda bulunduklarından IPTG indüklemesine
hazır hale gelmektedirler. Bu değerde ölçüm alındıktan sonra örnekler 50 ml’lik olacak
şekilde bölünmüştür.
50 ml’lik negatif kontrol E.coli BL21(DE3) hücre kültürüne ve 50 ml’lik FnENO genini
içeren E.coli BL21(DE3) hücre kültürüne son konsantrasyonları 0,5 mM olacak şekilde
IPTG indüklemesi yapılmıştır. İndüklenmemiş hücre kültürleri ile birlikte indüklenmiş
hücre kültürleri aynı zamanda 30 0C’de 180 devirde inkübe edilmiştir. 3 saat, 5 saat ve
gece boyunca bekletme sonunda kültürlerden 3 ml’lik örnekler alınmıştır. 4 0C’de 5000
37
rpm’de 20 dk santrifüj edilmiştir. Santrifüj sonunda örneklerden süpernatantlar atılarak
kalan hücre pelletleri kullanılmıştır.
Tüm hücre pelletleri 500’er µl Tris-HCl (pH 7.4) tamponu ile çözdürülmüştür.
Hazırlanan pelletlerin, %20’lik güç kullanılarak 10 sn sonikasyon 20 sn bekleme olacak
şekilde 6 döngülük ultrasonikasyonu yapılmıştır. Ultrasonikasyonu yapılan örnekler
+40C’de 20 dk 14000 rpm’de santrifüj edilmiştir. Elde edilen örneklerin süpernatant ve
pelletleri ayrı ayrı hazırlanmıştır [53] .
2.2.5 Sodyum Dodesil Sülfat Poliakrilamid Jel Elektroforezi
SDS poliakrilamid jel elektroforezi BIO-RAD Mini-PROTEAN 3 CelI jel elektroforez
sistemi kullanılarak yapılmıştır. SDS-PAGE’de kullanılan jel, ayırma ve yükleme jeli
olarak hazırlanmıştır.
Hazırlanan örneklere aynı miktarda SDS-PAGE örnek uygulama tamponu eklenmiştir ve
5 dakika kaynar suyun buharında bekletilmiştir. Jelde bulunan kuyucuklara bu örnekler
yüklenmiştir. Elektroforez tamponu olarak 1 x TAE kullanılmıştır. Örnekler 75 voltta
bromfenol mavisi jelin sonuna gelinceye kadar yürütülmüştür. Jel protein boyama
çözeltisinde bir gece boyunca oda sıcaklığında boyanmıştır ve daha sonra boya
uzaklaştırıcı çözelti içerisinde protein bantları net bir şekilde gözlenene kadar
bekletilmiştir. Elde edilen jel örnekleri uygun koşullarda saklanmıştır [54].
2.2.6 Fusobacterium nucleatum Enolaz Enziminin Saflaştırılması
Protein saflaştırma öncesinde ekspresyon için 100 ml LB sıvı besiyeri 100 µl amfisillin
eklenerek hazırlanmıştır. Bu besiyerine 1 ml FnENO genini içeren E.coli BL21(DE3)
hücreleri ekilmiştir. 600 nm’de OD değeri 0,6 olana kadar 37 0C’de 180 devirde inkübe
edilmiştir. Son konsantrasyon 0,5 mM olacak şekilde IPTG indüklemesi yapılmıştır ve 30
0
C’de 180 devirde 5 saat inkübe edilmiştir. Elde edilen hücre kültürü 4 0C’de 5000
rpm’de 20 dk santrifüj edilmiştir. Süpernatantlar atılmıştır ve hücre pelletleri 3 ml lizis
tamponunda çözdürülmüştür. Hazırlanan pelletlerin, %40’lik güç kullanılarak 10 sn
sonikasyon 10 sn bekleme olacak şekilde 6 döngülük ultrasonikasyonu yapılmıştır.
Ultrasonikasyon yapıldıktan sonra; 14000 rpm’de 4 0C’de 30 dk santrifüj edilmiştir. Bu
aşamada süpernantlar alınmıştır.
38
Elde edilen yaklaşık 4 ml hücre lizatı, 1 ml nikel nitrilotriasetik asit (Ni-NTA) agaroz ile 1
saat boyunca 4 0C’de 120 rpm’de karıştırılmıştır. Bu sırada kolon hazırlaması için, 5
ml’lik şırınga alınarak alt yüzeyine kurutma kağıdı konulmuştur ve 2 ml’ye kadar cam
yünü eklenmiştir. Uç kısmına tubing geçirilerek kolon hazırlanmıştır. Hücre lizatı ve NiNTA agaroz karışımı kolona yüklenmiştir. İlk süzüntü fraksiyonu toplanmıştır. Kolon iki
defa 4 ml yıkama tamponu ile yıkanmıştır ve yıkama fraksiyonları (Y 1, Y2, Y3)
toplanmıştır. Son olarak 4 ml elüsyon tamponu kullanılarak elüsyon fraksiyonları
toplanmıştır [55]. Toplanan örneklerin her birinden 30 µl alınarak aynı miktar SDSPAGE örnek uygulama tamponu ile 2.2.5’te verilen şekilde SDS-PAGE için
hazırlanmıştır.
2.2.7 Fusobacterium nucleatum Enolaz Enziminin Molekül Ağırlığı ve Molar
Absorblama Katsayısının Değerlerinin Hesaplanması
Protein konsantrasyon değerinin hesaplanması için saflaştırılan enzimin molekül ağırlığı
ve molar absorblama değerlerinin bulunması gerekmektedir. Bu değerler web tabanlı
bir program olan “Peptide Proporties Calculator” ile hesaplanmıştır [56]. Bu programa
aminosit dizisinin girilmesiyle istenen değerler elde edilmiştir.
2.2.8 Saflaştırılmış Fusobacterium nucleatum Enolaz Enziminin Konsantrasyonun
Hesaplanması
Enolaz enziminin konsantrasyonun hesaplanması için saflaştırılan proteinin UV
spektrofotometrede 280 nm’de (A280) ölçümü alınmıştır. Konsantrasyon hesaplaması
Lambert-Beer yasasına göre yapılmıştır. Protein konsantrasyonu (c), molar absorblama
katsayısı (ε) ve molekül ağırlığı (MW) değerleri kullanılarak aşağıdaki şekilde
hesaplanmıştır:
c (mol/l) = (A280)/ (ε x L)
(2.1)
c (mg/l) = (A280)x MW / (ε x L)
(2.2)
L, hücre yol uzunluğunu (cm) ifade etmektedir ve bu çalışmada kullanılan kuartz
küvette hücre yol uzunluğu 1 cm’dir. Buna göre yukarıdaki eşitlikler aşağıdaki şekilde
hesaplanabilmektedir [57]:
39
c (mol/l) = (A280)/ (ε)
(2.3)
c (mg/l) = (A280)x MW / (ε)
(2.4)
2.2.9 Fusobacterium nucleatum Enolaz Enziminin Optimum pH ve Spesifik Aktivite
Değerlerinin Belirlenmesi
Enolaz enziminin aktivite ölçümü, UNICAM UV/Vis spektrometre kullanılarak 2fosfogliserik asidin (2-PGA) fosfoenol pirüvata (PEP) dönüşümünün 240 nm’de
belirlenmesiyle yapılmıştır. 240 nm dalga boyunda fosfoenol pirüvatın (PEP) artışı
ölçülmüştür. Bu reaksiyonda 2-PGA substrat, MgCl2 kofaktör olarak kullanılmıştır.
Reaksiyon hacmi 1 ml ve reaksiyon süresi 2 dakika olarak belirlenmiştir. Ölçüm 1,5 mM
2-PGA, 1,5 mM MgCl2 ve 50 mM Tris-HCl tampon içerisinde 25
0
C’de
gerçekleştirilmiştir. Reaksiyon 1 ml kuartz küvete tampon, MgCl2 ve substrat
ilavesinden sonra enzim eklenerek başlatılmıştır [58]. Optimum pH deneyinde bu
reaksiyon farklı pH’taki Tris-HCl (pH 6.5, pH 7.0, pH 7.5, pH 8.0, pH 8.5, pH 9.0, pH 9.5)
tamponlarında aynı bileşenler kullanılarak gerçekleştirilmiştir [39], [59].
F. nucleatum enolaz enziminin en yüksek aktiviteyi gösterdiği pH değeri belirlendikten
sonra bu pH’da belirlenen absorbans değeri ele alınarak spesifik aktivite değeri
hesaplanmıştır. Reaksiyonda oluşan fosfoenolpirüvat ile absorbans artışı tayin
edildiğinden dolayı bu hesaplamada PEP’in molar absorblama katsayısı (εPEP)
kullanılmıştır. Toplam reaksiyon hacminin (VT) ve kullanılan enzim hacminin (VE)
hesaba katıldığı enzim aktivitesi Ünite/ml (U/ml) olarak aşağıdaki (2.5) denklemine
göre hesaplanmıştır [58]:
U/ml = (ΔA240/dk) x VT / (εPEP x VE)
(2.5)
Belirlenen bu değer enzim konsantrasyonuna bölünerek 1 mg protein başına düşen
enzim ünitesi hesaplanmıştır. Böylece spesifik enzim aktivitesi belirlenmiştir.
40
2.2.10 Fusobacterium nucleatum Enolaz Enzimin Termostabilitesinin Belirlenmesi
Enolaz enzimin termostabilitesinin belirlenmesi deneyi, sabit pH’daki Tris-HCl 2.2.9’da
belirtilen reaksiyon bileşenleri ile 240 nm’de ölçüm alınarak yapılmıştır. Bu deneyde
enzim sırasıyla 60 0C, 40 0C, 30 0C’de su banyosunda 15 dakika bekletilmiştir. Her 3
dakikada bir ölçüm alınarak termostabilitesi belirlenmiştir [39],[58],[59].
2.2.11 Saflaştırılmış Enzimin Kinetik Analizi
Michaelis-Menten
kinetiği;
enzim
katalizleme
reaksiyonunun
başlangıç
konsantrasyonuna bağlı olduğunu açıklamaktadır [60]. Şekil 2.3’te substratın (S) bir
enzimin (E) katalizlemesi sonucu ürüne (Ü) dönüştüğü reaksiyon gösterilmiştir. [ES]
enzim-substrat kompleksini tanımlamakta ve k1, k-1 ve k2 reaksiyon sabitleridir [61].
Şekil 2. 3 Enzim katalizlemesi ile substratın ürüne dönüşüm reaksiyonu [60].
Enzim-substrat kompleksinin ayrışma (k2) reaksiyonunun; birleşme (k1) ve tekrarayrışma (k-1) reaksiyonlarından daha yavaş olduğu düşünülmektedir ve ters reaksiyon
(Ü→S) ihmal edilebilir düzeydedir [61]. Bu işlemler göze alınarak yapılan hesaplamalar
sonucunda reaksiyon hızını belirlemek için aşağıdaki Michaelis-Menten denklemi elde
edilmektedir [62]:
(2.5)
Bu eşitlikte verilen Km (mol.l−1) değeri; sabit bir pH, sıcaklık ve redoks durumunda,
belirli bir enzim için sabittir ve bu parametre, bu enzimin substrata bağlanma gücünün
bir göstergesidir. Vmax ise bir enzimin elde edebileceği maksimum hızdır. Bu ölçüm
teoriktir. Çünkü Vmax değeri substratlara tamamen bağlanmış bütün enzim
moleküllerini gerektirmektedir ve hiçbir zaman bu değere ulaşamaz. Ayrıca; enzime
bağlanan substrat değeri Km değerine ulaştığında reaksiyon hızı Vmax’ın yarısı
olmaktadır. (Şekil 2.4).
41
Şekil 2. 4 Reaksiyon hızı ve substrat konsantrasyonuna bağlı Michaelis-Menten
denkleminin grafiği [62].
kcat (s-1) değeri ise; birim enzimin birim zamanda substrat ile doyurulması sonucunda
oluşan ürünün maksimum katalitik üretiminin bir ölçüsüdür. Bu değer aşağıdaki
denklemde gösterildiği gibi; Vmax’ın ortamda bulunan toplam enzim konsantrasyonuna
bölünmesi ile bulunmaktadır [61]. Ayrıca; kcat/Km (s–1 (mol.l–1)−1) oranı katalitik verim
olarak tanımlanmaktadır ve substrat spesifitesinin bir ölçüsü olarak alınabilmektedir
[61].
(2.6)
Michaelis-Menten denklemindeki kinetik sabitlerin (Km ve Vmax) daha basit bir şekilde
belirlenmesi için 1934 yılında Lineweaver-Burk, Michaelis-Menten denkleminin karşıt
formunu tanımlamıştır. Bu denklem aşağıda gösterildiği gibidir [62]:
(2.7)
Bu denklemin karşıt formu Şekil 2.5’te verilen grafikte görüldüğü gibi düz bir çizgi
oluşturmaktadır ve bu çizginin Y eksenindeki kesişim noktası 1/Vmax, X eksenindeki
kesişim noktası ise -1/Km değerini göstermektedir. Ayrıca bu grafikten elde edilen eğim
Km/Vmax değerini vermektedir. Michaelis-Menten denklemi analizindeki bu gelişme,
enzim sistemlerinin katalitik aktivitesi değiştiğinde bileşiklerin etkisini basit bir şekilde
analiz etmeyi sağlamaktadır [62].
42
Şekil 2. 5 Lineweaver-Burk denkleminin grafiği [62].
Yapılan bu çalışmada 240 nm dalga boyunda reaksiyon sonucunda oluşan fosfoenol
pirüvatın (PEP) artışı ölçülmüştür. Reaksiyon hacmi 1 ml ve reaksiyon süresi 2 dakika
olarak belirlenmiştir. Ölçüm 1,5 mM MgCl2 ve 50 mM Tris-HCl (pH 8,5) (deney
sonucunda belirlenen optimum pH) tampon içerisinde 25 0C’de gerçekleştirilmiştir
[58]. Saflaştırılan enzimin bu koşullarda farklı substrat konsantrasyonlarındaki
reaksiyon sonuçlarına göre kinetik özellikleri belirlenmiştir. Ölçümler birkaç kez
tekrarlanarak alınmıştır. Elde edilen reaksiyon değerleri ile GraFit 3.0 programı [63]
kullanılarak enzimin kararlı hal kinetik grafiği elde edilmiştir ve Km, Vmax değerleri
hesaplanmıştır. Vmax, enzim konsantrasyonu (Me), PEP’in molar absorblama katsayısı
(εPEP) kullanılarak aşağıdaki eşitliklerde verildiği gibi kcat hesaplaması yapılmış ve daha
sonra Km değeri hesaba katılarak katalitik verim bulunmuştur [53].
B = (Vmax/εPEP)/60
(2.8)
kcat = B / Me
(2.9)
2.2.12 F.
nucleatum
Enolaz
Enziminin
Homoloji
Modellemesi
ve
Süperimpozisyonlarının Yapılması
Klonlanan F. nucleatum enolaz proteninin aminoasit dizisi kullanılarak homoloji
modellemesi yapılmıştır. Homoloji modelleme; kalıp belirleme, eşleştirme, model
oluşturma ve validasyon aşamaları takip edilerek yapılmıştır [64]. Öncelikle FnENO
aminoasit dizisi web tabanlı BLAST programına girilmiştir ve Protein Data Bank (PDB)’
43
taki diğer proteinlerle eşleştirilerek kalıp protein belirlenmiştir [65], [66]. Web tabanlı
Clustal Omega programı kullanılarak kalıp proteinin aminoasit dizisi ile FnENO
proteininin aminoasit dizisinin eşleştirmesi yapılmıştır ve identity yüzdesi belirlenmiştir
[67]. Protein modellemesi MODELLER v9.12 programı kullanılarak yapılmıştır [68]. Bu
yazılıma FnENO aminoasit dizisi ile kalıp protein 3 boyutlu yapısı girilmiş ve dizi
eşleştirmeleri program tarafından yapılarak 50 farklı model oluşturulmuştur.
Discrete Optimized Protein Energy (DOPE) skoru en düşük olan belirlenerek validasyon
aşamalarına geçilmiştir.
Protein modelinin geometrisi, HyperChem versiyon 8.07 programında AMBER99
forcefiled (FF) kullanılarak 250 döngüde optimize edilmiştir [69]. Enerji optimizasyonu
yapılan protein yapısının validasyonu yapılmıştır.
Validasyon aşamasında 3 farklı web tabanlı sunucu kullanılmıştır. ERRAT Versiyon 2.0
serverı ile proteinin 3 boyutlu yapısında bulunan atomlar arasındaki hatalar istatiksel
olarak belirlenmiştir [70]. ProSA programı ile proteinin, X-ray kristalografisinde ve
NMR’da çözülmüş diğer proteinler ile eşleştirilmesi yapılmış ve enerji skoru ile
konformasyonu değerlendirilmiştir [71]. Son olarak validasyon için RAMPAGE programı
kullanılmış ve Ramachandran diyagramı gösterilmiştir [72].
Proteinin ikincil yapısının analizi SOPMA programı kullanılarak yapılmıştır [73].
Muhtemel ilaç bölgelerinin belirlenmesi ise; Q-SiteFinder ve DoGSiteScorer programları
ile yapılmıştır [74], [75].
Son olarak; Homo sapiens akciğer, beyin ve kas hücrelerinin enolaz dizileri NCBI veri
tabanından bulunmuştur [45]. Daha sonra bu diziler ve kalıp protein ile FnENO
aminoasit dizisinin süperimpozisyonu MolSoft-ICM Browser 3.7-2d (MolSoft LLC, San
Diago, CA, ABD) program kullanılarak yapılmıştır. Root-mean-square deviation (RMSD)
değerleri web tabanlı program olan SuperPose versiyon 1.0 kullanılarak belirlenmiştir
[76].
44
BÖLÜM 3
SONUÇLAR VE TARTIŞMA
3.1
Fusobacterium nucleatum Enolaz Enzimini Kodlayan Genin pGEM®-T Easy
Vektör Sistemine Klonlanması
3.1.1 Amplifikasyon Primerlerinin Tasarlanması
F. nucleatum genomik DNA’sının hangi soydan temin edildiği ilk aşamada
bilinmediğinden uygun primerlerin tasarlanması için NCBI’dan [45] dizileri belirlenen F.
nucleatum’un üç alt türünün enolaz dizileri eşleştirilmiştir. Fusobacterium nucleatum
subsp. polymorphum ATCC 25586, Fusobacterium nucleatum subsp. polymorphum
ATCC 10953 ve Fusobacterium nucleatum subsp. polymorphum F0401 türlerinin enolaz
dizileri alınarak Şekil 3.1 ve Şekil 3.2’de verilen eşleştirme yapılmıştır.
Şekil 3. 1 F. nucleatum üç alt türünün enolaz enzimini kodlayan gen dizilerinin
eşleştirmesi sonucundaki 5’ ucu nükleotid dizisi
Şekil 3. 2 F. nucleatum üç alt türünün enolaz enzimini kodlayan gen dizilerinin
eşleştirmesi sonucundaki 3’ ucu nükleotid dizisi
45
Eşleştirme sonucuna göre 5’ ucunda bütün nükleotidlerin aynı olduğu görülmüştür ve
aynı diziler baz alınarak 5’ primeri tasarlanmıştır. 3’ ucuna bakıldığında ise üç
nükleotidin farklı olduğu görülmüştür. 3’ primeri dejenere primer olarak aşağıdaki
şekilde tasarlanmıştır(W: T ya da A, R: C ya da T).
3’ primeri: 5’ TTTTTTWATRTTATARAAAACATC 3’
5' primeri: 5'ATGACAGGTATAGTAGAAGTAATTGG 3'
3.1.2 FnENO Geninin Amplifikasyonu ve E.coli DH5α Hücrelerine Transformasyonu
Tasarlanan primerler ile üç farklı polimeraz enzimi kullanılarak genomik DNA amplifiye
edilmiştir. Bu deneyde 3’→ 5’ ekzonükleaz aktivitesi olduğu bilinen Pfu DNA polimeraz
ve termostabil bir enzim olan ancak 3’→5’ ekzonükleaz aktivitesi olmayan Taq DNA
polimeraz kullanılmıştır. Ayrıca 5’→3’ polimeraz ve 3’→5’ ekzonükleaz aktivitesi
bulanan başka bir termostabil bir enzimin karışımı olan Long PCR Enzim Mix (Thermo
Scientific, #K0181, ABD) kullanılmıştır.
Belirlenen PCR koşullarında yapılan amplifikasyon sonucunda Şekil 3.3’teki agaroz jel
elektroforezi görüntüsüne göre Taq DNA polimeraz ve Long PCR Enzim Mix’in FnENO
geninin doğru büyüklükte amplifiye ettiği görülmüştür. Long PCR Enzim Mix’in 3’→5’
ekzonükleaz aktivitesi bulunduğundan ve Taq DNA polimeraza göre çok daha yüksek
verimde reaksiyonu gerçekleştirdiğinden bu enzim ile çalışılmasına karar verilmiştir.
Şekil 3. 3 PCR ile amplifiye edilen FnENO geninin agaroz jel elektroforez görüntüsü. Hat
1: Taq DNA polimeraz kullanılarak yapılan PCR ürünü, Hat 2: Pfu DNA Polimeraz
kullanılarak yapılan PCR ürünü, Hat 3: Long PCR Enzim Mix kullanılarak yapılan PCR
ürünü, Hat M: GeneRuler DNA Markır
46
FnENO geninin pGEM®-T Easy Vektör sistemine klonlamasının yapılması için tekrar
Long PCR Enzim Mix ile aynı koşullarda PCR yapılmıştır. Saflaştırma sonrası yapılan
agaroz jel elektroforezinde görüldüğü gibi FnENO geni doğru büyüklükte amplifiye
edilmiştir (Şekil 3.4).
Şekil 3. 4 Long PCR Enzim Mix ile oluşan PCR ürününün agaroz jel elektroforezi
görüntüsü. Hat M1: GeneRuler DNA Markır, Hat 1 ve 2: PCR ürünü, Hat M2: Lambda
Markır
Saflaştırılan PCR ürünü pGEM®-T Easy Vektörüne aktarılmış ve devamında
transformasyon basamakları uygulanarak elde edilen rekombinant DNA E.coli DH5α
hücrelerine aktarılmıştır. Transformasyon sonrasında amfisilin içeren LB-BSA
petrilerinde negatif olan mavi ve muhtemel pozitif olan beyaz koloniler görülmüştür
(Şekil 3.5). Beyaz kolonilerden 3 tanesi seçilerek 5 ml’lik amfisilinli sıvı besiyerine
alınmış ve bir gece inkübe edilmiştir.
Şekil 3. 5 pGEM®-T Easy Vektör Sistemi ile yapılan klonlama sonrası transformasyonda
LB-BSA petrilerinde görülen koloniler
47
3.1.3 Klonlanan Genin Kontrolü ve Dizi Analizi
İnkübe edilen plazmid DNA izolasyonu yapılmıştır. Elde edilen rekombinant plazmid
DNA’ların Long PCR Enzim Mix kullanılarak 5’ ve 3’ primerleri kullanılarak PCR ile
amplifikasyon yapılmıştır. Beyaz kolonilerden rastgele seçilen üç koloninin de pozitif
olduğu agaroz jel elektroforezinde görülmüştür (Şekil 3.6).
Şekil 3. 6 Klonlanan genin PCR ile yapılan kontrolünün jel görüntüsü. Hat M1: Lambda
Markır, Hat M2: GeneRuler DNA Markır, Hat 1-3: Seçilen kolonilerden elde edilen
plazmid DNA’lar ile yapılan PCR sonucu
Bu kolonilerden elde edilen rekombinant plazmid DNA’lar dizi analizinin yapılması için
Iontek firmasına gönderilmiştir. Dizilemesi yapılan gen, NCBI’da [45] kayıtlı olan üç
FnENO gen dizisi ile Clustal W2 [50] programı kullanılarak eşleştirmesi yapılmıştır.
Yapılan eşleştirme sonucunda genomik DNA’nın yüksek oranda Fusobacterium
nucleatum subsp. polymorphum ATCC 10953 suşundan elde edildiği tespit edilmiştir
(Şekil 3.7).
48
Şekil 3. 7 Fusobacterium nucleatum subsp. polymorphum ATCC 10953 enolaz geni (1.
sıra) ile bu çalışmada klonlanan genin (2. sıra) dizi analizi
49
Dizi analizi sonucuna bakıldığında 3’ ucunda iki farklı nükleotidin bulunduğu
görülmektedir. Bu iki gen dizisinin aminoasit dizisi oluşturularak eşleştirme yapılmıştır.
3’ ucundaki nükleotid farklılıklarının aminoasit dizisinde bir değişiklik oluşturmadığı
görülmüştür. Elde edilen bu sonuçlardan sonra; pGEM®-T Easy Vektör sistemine
aktarılan FnENO genini içeren E. coli DH5α hücre kültürlerinin -80 0C’de saklamak üzere
stok kültürleri hazırlanmıştır.
3.2
Fusobacterium nucleatum Enolaz Enzimini Kodlayan Genin pLATE 31
Ekspresyon Vektörüne Klonlanması
3.2.1 FnENO
Geninin
Amplifikasyonu
ve
E.
coli
BL21(DE3)
Hücrelerine
Transformasyonu
-80 0C’de stoku bulunan FnENO genini içeren E. coli DH5α hücre kültüründen öze ile
örnek alınarak amfisilin içeren LB agarlı besiyerine sürme ekim yapılmış ve 37 0C’de bir
gece inkübe edilmiştir. Petriden tek koloni seçilerek 5 ml amfisilinli LB sıvı besiyerine
ekimi yapılmış ve tekrar 37 0C’de bir gece inkübe edilmiştir. Bu kültürden rekombinant
plazmid DNA’lar elde edilmiştir. aLICator LIC Klonlama ve Ekspresyon Kit 3 (C-terminal
His-tag) sistemi [44] protokolüne göre hazırlanan primerler ile daha önceki
amplifikasyonlarda da kullanılan üç farklı DNA polimeraz kullanılarak PCR yapılmıştır.
Agaroz jelde FnENO genini sadece Taq DNA Polimerazın doğru büyüklükte amplifiye
ettiği görülmüştür. Ancak amplifiye edilen genin dışında reaksiyona katılmayan
primerler de bant oluşturmuştur (Şekil 3.8).
Yapılan deneyler sonucunda aLICator LIC Klonlama ve Ekspresyon Kit 3 (C-terminal Histag)
sistemi
protokolüne
göre
hazırlanan
primerler
ile
yapılacak
olan
amplifikasyonlarda Taq DNA polimerazın kullanılmasına karar verilmiştir. FnENO geni
ligasyon ve transformasyon aşamaları için tekrar Taq DNA polimeraz kullanılarak PCR
ile amplifiye edilmiştir.
50
(A)
(B)
Şekil 3. 8 FnENO geninin amplifikasyon sonucu. (A) Hat M1: GeneRuler DNA Markır,
Hat 1: Taq DNA polimeraz kullanılarak yapılan PCR ürünü, Hat M2: Lambda Markır, Hat
2: Long PCR Enzim Mix kullanılarak yapılan PCR ürünü. (B) Hat M1: GeneRuler DNA
Markır, Hat 1: Pfu DNA polimeraz enzimi kullanılarak yapılan PCR ürünü, Hat 2: Taq
DNA polimeraz kullanılarak yapılan PCR ürünü.
Ortamda bulunan primerleri uzaklaştırmak için PCR ürünleri kristal viyole agaroz jelde
yürütülmüştür. PCR amplifikasyon ürünü jelden kesilerek alınmış ve saflaştırılmıştır.
Saflaştırma sonrası doğru genin elde edildiğini göstermek için DNA örnekleri agaroz
jelde yürütülmüştür (Şekil 3.9).
Şekil 3. 9 FnENO geninin saflaştırma sonrası agaroz jel elektroforez görüntüsü. Hat M1:
GeneRuler DNA Markır, Hat 1: Saflaştırılmış FnENO geni.
51
1302 baz çift büyüklüğündeki genin vektör DNA’ya ligasyonu için aLICator LIC Klonlama
ve Ekspresyon Kit 3 (C-terminal His-tag) sistemi protokolüne göre yaklaşık 90 ng örnek
gerekmektedir [44]. Şekil 3. 9’da görülen DNA bandının konsantrasyonu Lambda
DNA/Hind III markır ile kıyaslanarak 1 µl’de yaklaşık 30 ng olarak belirlenmiştir.
Reaksiyon sistem protokolüne göre yapılmış ve FnENO geninin pLATE 31 vektörü ile
ligasyonu gerçekleştirilmiştir (Çizelge 3.1).
Ligasyon, kit içerisinde bulunan T4 DNA polimerazın 3’→5’ ekzonükleaz ve 5’→3’
polimeraz aktiviteleri sayesinde gerçekleştirilmektedir. pLATE 31 vektörü içerisinde T7
promotörü bulunmaktadır. Bu nedenle vektör ile oluşturulan rekombinant plazmid
DNA’lar, IPTG ile indüklenebilen lacUV5 promotörünün kontrolü altında T7 RNA
polimeraz genini içeren BL21(DE3) gibi bir E. coli suşuna transforme edilebilmektedir
[44].
Çizelge 3. 1 Ligasyon reaksiyonunun bileşenleri
Bileşenler
Hacim
5 x LIC Tampon
2 µl
Saflaştırılmış PCR Ürünü
3 µl (90 ng)
Su
4 µl
T4 DNA Polimeraz, 1u/µl
1 µl
Toplam
10 µl
Ligasyon aşamasından sonra transformasyon 2.2.2.4’te belirtilen şekilde yapılmıştır.
Transformasyon sonrası elde edilen hücrelerin amfisilin içeren LB agarlı petrilere sürme
ekimi yapılarak bir gece 37 0C’de inkübe edilmiştir. İnkübasyon sonrası koloniler elde
edilmiştir.
3.2.2 Gen Aktarımının Kontrolü ve Dizi Analizi
Aktarılan genin kontrolü koloni PCR ile yapılmıştır. Petrilerden 9 koloni seçilerek
plazmid DNA elde edilmiş ve Taq DNA polimeraz ile koloni PCR koşullarında amplifiye
edilmiştir. 9 koloniden 5’i pozitif sonuç vermiştir (Şekil 3.10).
52
Şekil 3. 10 Koloni PCR sonrasında elde edilen agaroz jel elektroforez görüntüsü. Hat
M1: GeneRuler DNA Markır; Hat 1,3,7 ve 9: Negatif PCR sonucu, Hat 2,4,5,6 ve 8:
Pozitif PCR sonucu
Pozitif çıkan sonuçlardan dördüncü koloni seçilerek 5 ml’lik sıvı besiyerindeki kültürden
-80 0C’de saklanmak üzere stok kültür hazırlanmıştır. Ayrıca; bu kültürden plazmid
DNA’lar izole edilmiştir. Bu plazmid DNA’lar, aLICator LIC Klonlama ve Ekspresyon Kit 3
(C-terminal His-tag) sistemi içerisinde hazır olarak bulunan pLATE 31 ekspresyon
vektörüne uygun primerler [44] ile çift yönlü dizileme için Biogen firmasına
gönderilmiştir. Dizileme sonucunda, önceden pGEM®-T Easy Vektörüne klonlanmış
olan gen dizisi referans alınarak eşleştirme yapılıp FnENO geninin tam ve doğru olarak
dizilendiği görülmüştür. Alt-klonlama sonrası dizileme işlemi, gen amplifikasyonunun
3’→5’
ekzonükleaz
aktivitesi
olmayan
enzim
kullanılarak
yapıldığı
için
gerçekleştirilmiştir. Ek olarak; saflaştırma için gerekli olan 6xHis-tag dizisinin, genin 3’
ucuna başarılı olarak eklendiği belirlenmiştir (Şekil 3.11).
53
Şekil 3. 11 Alt-klonlama ile FnENO gen dizisine eklenen 6xHis-tag bölgesinin gösterimi.
(A) FnENO gen dizisi (1. sıra) ve önceden klonlanan FnENO gen dizisinin (2. sıra)
eşleştirmesi sonucunda belirlenen 6xHis-tag bölgesi (B) 6xHis-tag bölgesinin
kromatogram görüntüsü.
3.2.3 FnENO Dizisinin Aminoasit Düzeyinde Karşılaştırmalı Analizi ve FnENO
Enziminin Filogenetik Analizi
Bu çalışmada klonlanan ve karakterizasyonu yapılan FnENO dizisinin aminoasit
düzeyinde karşılaştırmalı analizi web tabanlı bir yazılım olan Clustal W2 [50] programı
kullanılarak gerçekleştirilmiştir. Bu amaçla konak olan H. sapiens enolaz2 (HuENO2)
(insan nöron spesifik gamma-2 enolaz, erişim no: M22349.1), H. sapiens enolaz3
(HuENO3) (insan kas spesifik beta enolaz izoform 1, erişim no: X55976.1) ile yapılan
analiz sonucunda, enolaza ait katalitik rezidüler FnENO'da da belirlenmiştir. Şekil 3.
12'de analiz sonucu belirlenen katalitik rezidüler kırmızı kutu ile gösterilmiştir. FnENO
proteininin homoloji modellemesi yapılarak muhtemel ilaç hedef bölgelerinin
belirlenmesi bölüm 3.2.9'da sunulmuştur.
54
Şekil 3. 12 Enolazın çoklu dizi eşleştirmesi. Bu eşleştirme sonucunda kırmızı kutucuklar
katalitik rezidüleri belirtmektedir. H. sapiens enolaz2 (nöron spesifik gamma-2 enolaz)
aminoasit dizisi (1. sıra), H. sapiens enolaz3 (kas spesifik beta enolaz izoform 1)
aminoasit dizisi (2. sıra), Theileria annulata enolaz aminoasit dizisi (3. sıra)
Fusobacterium nucleatum enolaz aminoasit dizisi (4. sıra) bu eşleştirmede
kullanılmıştır.
Bu çalışmada klonlanan FnENO’nun filogenetik analizi konağı H. sapiens enolaz
formları ve referans dizi olarak daha önce klonlanmış Theileria annulata enolazı ile
mRNA düzeyinde benzerlik araştırması yapılarak gerçekleştirilmiştir. Elde edilen
filograma göre, H. sapiens enolazları aynı grupta yer almakta iken T.annulata ve F.
nucleatum enolazları ayrı gruplar olarak yer almıştır (Şekil 3. 13). Referans dizi olarak
kullanılan ve bir apikompleksan paraziti olan T. annulata enolazı BLAST analizine de
uygunluk göstererek insan enolazına daha yakın gruptadır ve bu diziyi ayrı bir grup
olarak F. nucleatum enolazı takip etmektedir.
Şekil 3. 13 FnENO’nun filogenetik ağacı
55
3.2.4 Fusobacterium nucleatum Enolaz Enziminin Ekspresyonu
F. nucleatum enolaz enziminin ekspresyonu için indükleyici olarak IPTG kullanılmıştır.
IPTG; lac operonu tarafından kontrol edilen genlerin protein ekspresyonunda tetikleyici
olarak görev yapmaktadır. lac operonunun represör molekülüne bağlanarak gen
bölgesinin açılmasına ve o bölgeye enzimin bağlanmasına yardımcı olmaktadır. Böylece
β- galaktosidaz gibi lac operonu ile kontrol edilen genlerin transkripsiyonunu,
dolayısıyla da ekspresyonunu tetiklemektedir [77]. Yapılan ekspresyon deneyinde 50
ml LB sıvı besiyerindeki hücre kültürlerine 0,5 mM IPTG eklenerek indükleme işlemi
yapılmıştır. FnENO genini içeren E. coli BL21(DE3) hücreleri hem indükleme yapılarak
hem de yapılmadan inkübe edilmiştir. Ayrıca; negatif kontrol için de FnENO genini
içermeyen E. coli BL21(DE3) hücreleri indükleme yapılarak ve yapılmadan inkübe
edilmiştir. Hücrelerin inkübe edilme süreleri 3 saat, 5 saat ve bir gece boyu olarak
ayarlanmıştır.
F. nucleatum enolaz enziminin molekül ağırlığı ve molar absorblama katsayısı
(extinction coefficient) Peptide Properties Calculator programı [56] ile belirlenmiştir.
FnENO’nun 433 aminoasitlik protein dizisi programa girilmiş ve bu değerler
hesaplanmıştır. Yapılan hesaplamalara göre; FnENO proteininin molekül ağırlğı 46370
g/mol (46,37 kDa) ve molar absorblama katsayısı 34070 cm-1 M-1 bulunmuştur. F.
nucleatum enolaz enziminin molekül ağırlığı ve molar absorblama katsayısı, protein
konsantrasyonunun
hesaplanmasında
ve
SDS-PAGE
analizlerinde
proteinin
büyüklüğünü belirleyebilmek için kullanılmıştır.
Ekspresyon sonrası elde edilen hücre lizatları SDS poliakrilamid jel elektroforezinde
yürütülmüştür. FnENO proteini Şekil 3.14 ve Şekil 3.15’te görüldüğü gibi indüklenen
örneklerin süpernatantta çözünür halde beklenen büyüklükte üretildiği görülmektedir
(Hat 7).
56
Şekil 3. 14 Hücrelerin 5 saat inkübe edilmesinin ardından elde edilen ekspresyon
sonucu. Hat M: Protein markır, Hat 1: İndüklenmeyen E. coli BL21(DE3) hücrelerinin
süpernatantı, Hat 2: İndüklenmeyen E. coli BL21(DE3) hücrelerinin pelleti; Hat 3:
İndüklenen E. coli BL21(DE3) hücrelerinin süpernatantı Hat 4: İndüklenen E. coli
BL21(DE3) hücrelerinin pelleti, Hat 5: İndüklenmeyen FnENO genini içeren E. coli
BL21(DE3) hücrelerinin süpernatantı, Hat 6: İndüklenmeyen FnENO genini içeren E. coli
BL21(DE3) hücrelerinin pelleti; Hat 7: İndüklenen FnENO genini içeren E. coli BL21(DE3)
hücrelerinin süpernatantı, Hat 8: İndüklenen FnENO genini içeren E. coli BL21(DE3)
hücrelerinin pelleti.
Şekil 3. 15 Hücrelerin bir gece boyunca inkübe edilmesinin ardından elde edilen
ekspresyon sonucu. Hat M: Protein markır; Hat 1: İndüklenmeyen E. coli BL21(DE3)
hücrelerinin süpernatantı, Hat 2: İndüklenmeyen E. coli BL21(DE3) hücrelerinin pelleti,
Hat 3: İndüklenen E. coli BL21(DE3) hücrelerinin süpernatantı, Hat 4: İndüklenen E.coli
BL21(DE3) hücrelerinin pelleti, Hat 5: İndüklenmeyen FnENO genini içeren E. coli
BL21(DE3) hücrelerinin süpernatantı Hat 6: İndüklenmeyen FnENO genini içeren E. coli
BL21(DE3) hücrelerinin pelleti, Hat 7: İndüklenen FnENO genini içeren E.coli BL21(DE3)
hücrelerinin süpernatantı Hat 8: İndüklenen FnENO genini içeren E.coli BL21(DE3)
hücrelerinin pelleti.
57
Laboratuarımızda yapılan önceki ekspresyon çalışmalarda 5 saatlik inkübasyon ile elde
edilen örneklerin enzim aktivitesi sonuçlarının gece boyunca inkübe edilen örneklere
göre daha iyi olduğu görülmüştür. Bu nedenle, bir sonraki saflaştırma aşamasına 5
saatlik inkübasyon ile elde edilen örneklerle devam edilmiştir.
3.2.5 Fusobacterium nucleatum Enolaz Enziminin Saflaştırılması
Fusobacterium nucleatum enolaz enziminin saflaştırılması için C- terminal bölgesine
polihistidin bölgesi eklenmiştir. Elde edilen bu rekombinant proteinin saflaştırılması
afinite kromotografisi ile yapılmıştır. Affinite kromatografisinde kolon dolgu malzemesi
olarak polihistidin bölgesi ile etkileşimi bilinen nikel nitrilotriasetik asit (Ni-NTA) agaroz
kullanılmıştır. Bu kolonda nikel iyonundaki altı bağlanma bölgesinin dördü NTA ile
kaplanmakta, kalan iki bağlanma bölgesi de 6xHis-tag bölgesi ile etkileşime
girmektedir. NTA, özellikle güçlü yıkama koşulları altında bile diğer şelat reçinelere
göre çok daha stabil bir şekilde metal iyonlarını bağlamaktadır ve çok çeşitli koşullarda
metal iyonlarını korumaktadır [55].
Saflaştırma yapılırken ilk önce 10 mM imidazol içeren lizis tamponu ile hücrelerin
sonikasyonu yapılmaktadır. Sonikasyon sonrasından Ni-NTA agaroz ile muamale
edilmektedir. Bu muamele sırasında imidazol ve protein Ni-NTA ile etkileşime
girebilmek için bir yarışa girmektedir. Bu aşamada protein konsantrasyonu daha fazla
olduğundan protein Ni-NTA ile daha fazla etkileşime girmektedir. 20 mM imidazol
içeren
yıkama
tamponu
ile
kolon
yıkanarak
ortamdaki
diğer
proteinler
uzaklaştırılmaktadır. Son olarak 250 mM imidazol içeren elüsyon tamponu kullanılarak
Ni-NTA ile imidazol etkileşimi arttırılmaktadır. Böylece kolonda bulunan protein serbest
kalarak elüsyonlarda saf olarak toplanması sağlanmaktadır [55].
FnENO proteini süpernatantta çözünür halde bulunduğundan doğal koşullarda
uygulanan saflaştırma yapılmıştır. Şekil 3.16’da verilen SDS-PAGE görüntüsündeki
elüsyon örneklerinde görüldüğü gibi FnENO proteini yüksek saflıkta elde edilmiştir.
Protein yüksek saflıkta elde edilmesine rağmen düşük konsantrasyonlarda üretilmiştir.
Bu durum kolonun iyi paketlenememesinden ya da çok fazla yıkama yapılmasından
dolayı proteinin kaybedilmesinden kaynaklanabilmektedir. Ancak elde edilen değerler
58
optimum pH deneyini yapabilmek için yeterli olduğundan tekrar saflaştırmaya
gidilmeden bu deneyler yapılmıştır.
(A)
(B)
Şekil 3. 16 Saflaştırma sonrası gerçekleştirilen SDS-PAGE görüntüleri. (A) Hat M: Protein
markır; Hat 1: Elüsyon 1, Hat 2: Elüsyon 2, Hat 3: Elüsyon 3, Hat 4: Elüsyon 4, Hat 5:
Elüsyon 5, Hat 6: Elüsyon 6, Hat 7: Elüsyon 7, Hat 8: Elüsyon 8, (B) Hat M: Protein
markır, Hat 1: İlk süzüntü, Hat 2: Yıkama 1, Hat 3: Yıkama 2, Hat 4: Yıkama 3, Hat 5:
Yıkama 4.
3.2.6 Fusobacterium nucleatum Enolaz Enziminin Optimum pH ve Spesifik Aktivite
Değerinin Belirlenmesi
FnENO proteinin en yüksek aktivite gösterdiği optimum pH’ın belirlenebilmesi için
standart reaksiyon 7 farklı pH’ta hazırlanan tamponlar içerisinde gerçekleştirilmiştir
[39], [59]. Reaksiyonda farklı pH’larda tampon (50 mM Tris-HCl + 1,5 mM MgCl), 2-PGA
59
(1,5 mM), dH2O ve saflaştırılmış enzim kullanılmıştır [58]. UV spektrofotometrede 240
nm’de bu reaksiyon 2 dakikalık bir sürede en az iki kez ölçüm alınarak
gerçekleştirilmiştir. Belirlenen bu deney iki farklı elüsyon örneği ile yapılmış ve elde
edilen absorbans değerlerinin ortalaması alınarak optimum pH bulunmuştur.
İlk optimum pH deneyinde 280 nm’deki absorbans değeri 0,012 olarak ölçülen elüsyon
8 örneği kullanılmış ve 1 ml’de 8,2 µg enolaz enzimi olacak şekilde farklı pH
değerlerinde reaksiyon gerçekleştirilmiştir. İkincisinde ise; 280 nm’deki absorbansı
0,011 olarak ölçülen elüsyon 6 örneği kullanılmış ve 1 ml reaksiyonda 7,5 µg enolaz
enzimi olacak şekilde deney tekrarlanmıştır. Absorbans değerleri ölçülerek enzimin
aktivitesi belirlenmiştir (Çizelge 3. 2). Belirlenen bu protein miktarları aşağıdaki şekilde
hesaplanmıştır:
(A280/ ε) x seyreltme faktörü x MW = M (mol/ml)
(3.1)
Reaksiyonda 10 µl enzim kullanıldığında;
M x 1. 10-2 = Ms (Son molarite) x 1 (ml)
(3.2)
MS x MW = C (µg/ml)
(3.3)
Yapılan her iki deneyde de çalışılan enzim konsantrasyonu değerleri birbirine yakın
olduğundan elde edilen absorbans değerlerinin ortalaması alınmış ve çıkan değerler
grafik üzerinde gösterilmiştir (Şekil 3.17).
Çizelge 3. 2 Çoklu tekrarlar sonrasında elde edilen ortalama absorbans değerleri
(ΔA240/dk)
pH
Aktivite Deney 1
(ΔA240/dk)
Aktivite Deney 2
(ΔA240/dk)
Ortalama Absorbans
(ΔA240/dk)
6,5
0,372
0,359
0,3655
7
0,470
0,481
0,4755
7,5
0,535
0,534
0,5345
8
0,633
0,580
0,6065
8,5
0,656
0,605
0,6305
9
0,518
0,477
0,4975
9,5
0,435
0,414
0,4245
60
Şekil 3. 17 Ortalama değerlere göre belirlenen pH-absorbans değerleri
Optimum pH deneyinin sonucunda FnENO enziminin en yüksek aktivite gösterdiği pH
değeri 8,5 olarak belirlenmiş ve kinetik analizlerde pH’ı 8,5 olan tampon kullanılarak
reaksiyonlar gerçekleştirilmiştir.
Optimum pH belirlendikten sonra, en yüksek absorbans değerinin ilk yapılan deneyde
pH’ı 8,5 olan tampon kullanılarak belirlenen ortalama absorbans değeri olduğu
görülmüştür ve bu veri kullanılarak enzimin spesifik aktivite değeri hesaplanmıştır. Bu
deneyde hazırlanan stok enzim konsantrasyonu 0,82 mg/ml’dir. 2.2.9’da verilen
formülde εPEP (1,4 mM-1. cm-1) değeri [58] ve hacim değerleri yerine konularak yapılan
hesaplama sonucunda enzim ünitesi 46,85 U/ml olarak hesaplanmıştır. Bu değer
protein konsantrasyonuna bölündüğünde elde edilen spesifik aktivite değeri 57,14
U/mg’dır.
3.2.7 Fusobacterium nucleatum Enolaz Enzim Termostabilitesinin Belirlenmesi
FnENO enziminin termostabilite deneyi enzimin belirli sıcalıklarda belirli sürelerde
inkübe edilmesi ile yapılmıştır. Belirli sıcaklıklarda inkübe edilen enzimin her 3 dakikada
bir 240 nm’de UV spektrofotometrede enolaz aktivitesi ölçülmüştür. Absorbans
değerleri belirlenerek FnENO enziminin aktivitesinin sıcaklıkla nasıl bir değişim
gösterdiği belirlenmiştir.
61
Reaksiyonlarda pH 8,5’ta tampon (50 mM Tris-HCl+ 1,5 mM MgCl), 2-PGA (1,5 mM),
dH2O ve enzim kullanılmıştır [58]. Yapılan bu deneyde 1 ml’de 5,44 µg saflaştırılmış
FnENO enzimi kullanılmıştır. Zamana bağlı olarak gerçekleştirilen reaksiyonun
absorbans değerleri Çizelge 3.3’te verilen şekilde belirlenmiştir.
Çizelge 3. 3 FnENO enziminin termostabilite deneyi sonucundaki absorbans değerleri
(ΔA240/dk)
Sıcaklık (0C)
Absorbans (ΔA240/dk)
3 dk
6 dk
9 dk
12 dk
15 dk
60
0,379
0,458
0,458
0,501
0,483
40
0,433
0,487
0,548
0,522
0,560
30
0,485
0,514
0,525
0,593
0,488
Elde edilen absorbans değerleri ile grafik oluşturulduğunda sıcaklık ile FnENO enziminin
aktivitesinin çok fazla değişmediği görülmüştür (Şekil 3.18). 60 0C’deki absorbans
değerlerine bakıldığında sıcaklık arttığında aktivitenin bir miktar azaldığı ancak
reaksiyonu önleyecek derecede bir değişimin olmadığı görülmüştür. Ayrıca; zaman
parametresinin de FnENO enzimi aktivitesi üzerinde bir değişiklik yapmadığı
belirlenmiştir. Uygulanan sıcaklıklarda 15 dakika sonunda da enzimin aktivitesinde
belirgin bir azalma ya da artmanın olmadığı görülmüştür.
Şekil 3. 18 FnENO enziminin termostabilite deneyi sonucunda elde edilen absorbans
değerleri ve zaman grafiği
62
3.2.8 Saflaştırılmış FnENO Enziminin Kinetik Analizinin Yapılması
FnENO enzimi kinetik analizinin yapılması için tekrar üretilmiştir ve 2.2.6’da belirtilen
saflaştırma protokolü uygulanmıştır. Saflaştırma sonucunda elde edilen elüsyonların
UV spektrofotometrede 280 nm’de absorbans değerleri ölçülmüş ve bu değerlere göre
en yüksek protein konsantrasyonuna sahip elüsyon kinetik analizde kullanılmıştır
(Çizelge 3.4). Ayrıca; belirlenen elüsyonun absorbans değeri kinetik parametrelerin
hesaplanmasında
kullanılmıştır.
Şekil
3.19’da
verilen
SDS
poliakrilamid
jel
elektroforezinde görüldüğü gibi FnENO enzimi yüksek oranda saf olarak elde edilmiştir.
Çizelge 3. 4 Saflaştırma sonrası seçilen elüsyonların 280 nm’deki absorbans değerleri
Elüsyonlar
E3
E4
E5
E6
E7
E8
Absorbans (A280)
0,032
0,026
0,016
0,017
0,016
0,015
Şekil 3. 19 Saflaştırma sonrası elüsyonlardan elde edilen FnENO enziminin SDS-PAGE
görüntüsü. Hat M: Protein markır; Hat 1,2,3,4,5,6,7,8 sırasıyla: Elüsyon 1, Elüsyon 2,
Elüsyon 3, Elüsyon 4, Elüsyon 5, Elüsyon 6, Elüsyon 7, Elüsyon 8
Saflaştırma sonrası FnENO enziminin substrat kinetiği analizi için elüsyon 3 örneği
kullanılmıştır. Farklı 2- PGA substrat konsantrasyonlarında, 1 ml’de 4,3 µg enzim
kullanılarak reaksiyon gerçekleştirilmiştir. 0,02-3,5 mM arasında değişen substrat
konsantrasyonlarında yapılan reaksiyonların 240 nm’de absorbans ölçümü alınmıştır.
Değişen konsantrasyonlarda üç kez tekrarlanarak alınan ölçümlere göre ortalama
absorbans değerleri Çizelge 3.5’te verilmiştir.
63
Değişen substrat konsantrasyonları ile yapılan deney sonucunda GraFit 3.0 programı
[63] kullanılarak elde edilen veriler ile Km ve Vmax değerleri hesaplanmıştır. Ayrıca; bu
program kullanılarak enzimin kararlı hal kinetik grafiği oluşturulmuştur (Şekil 3. 20).
kcat ise enzim konsantrasyonu, εPEP (1400 M-1 cm-1), Vmax değerleri kullanılarak
hesaplanmıştır. Öncelikle kullanılan 4,3 µg enzimin konsantrasyonu 9,27.10-8 M olarak
bulunmuştur. Elde edilen bu değerler 2.8, 2.9’da verilen denklemlerde kullanılmış ve
sonuç olarak kcat değeri bulunmuştur. Belirlenen Km değeri kullanılarak da kcat/Km değeri
belirlenmiştir.
Çizelge 3. 5 Değişen substrat konsantrasyonlarına göre ölçülen ortalama ΔA240/dk
değerleri
Substrat Konsantrasyonu (mM)
Ortalama Absorbans (ΔA240/dk)
0,02
0,0043
0,06
0,014
0,1
0,024
0,12
0,033
0,16
0,051
0,32
0,061
1,0
0,103
1,5
0,114
2,0
0,1325
2,5
0,134
3,0
0,138
3,5
0,140
64
Şekil 3. 20 FnENO enziminin kararlı hal kinetiği grafiği
Kinetik analiz sonucunda Fusobacterium nucleatum enolaz enziminin Km, Vmax, kcat,
kcat/Km değerleri literatürde ilk defa belirlenmiştir (Çizelge 3.6)
Çizelge 3. 6 F. nucleatum enolaz enziminin belirlenen kinetik özellikleri
Kinetik Özellik
Belirlenen Değer
Standart hata
Km
0,4825 mM
0,0043
Vmax
0,1587
0,0491
kcat
20,38 s-1
-
kcat/Km
4,22 x 104 M-1s-1
-
3.2.9 FnENO Enziminin Homoloji Modellemesinin Yapılması
Öncelikle FnENO enziminin aminoasit dizisi web tabanlı BLAST programına girilip PSIBLAST [65] algoritması kullanılarak PDB (Protien Data Bank) proteinlerine karşı protein
taraması gerçekleştirilmiştir [66]. Bu eşleştirme sonucunda homoloji modelleme için
identity değeri %30’un üzerinde olacak şekilde kalıp protein seçilmesi gerekmektedir
[65], [66]. Çıkan sonuçlardaki Maksimum Skor (573), Identity (%67) ve E-value (0.0)
değerlerine göre Enterococcus hirae enolaz (EhENO) enzimi kalıp protein olarak
65
seçilmiştir. EhENO’nun [78] 3 boyutlu yapısı Protein Data Bank kullanılarak bulunmuş
ve modelleme çalışmasında kalıp olarak kullanılmıştır (PDB ID: 1IYX)
Daha sonra FnENO ve EhENO enzimlerinin aminoasit dizileri Clustal Omega [67]
programı kullanılarak eşleştirilmiştir (Şekil 3. 21). Bu eşleştirme sonucuna göre identity
yüzdesi % 65,899 olarak belirlenmiştir.
Şekil 3. 21 FnENO (2. sıra) ve EhENO (1. sıra) enzimlerinin aminoasit dizilerinin
eşleştirilmesi
F. nucleatum enolaz enziminin üç boyutlu yapısı; Enterococcus hirae enolazının kristal
yapısı, FnENO aminoasit dizisi ve eşleştirme dosyası kullanılarak Modeller v9.12
programı [68] ile belirlenmiştir. Oluşturulan 50 farklı modelden içerisinden DOPE
(Discrete Optimized Protein Energy) skoru en düşük olan model ileriki çalışmalar için
seçilmiştir. Seçilen model 28’in DOPE Skoru -48462.25000 olarak belirlenmiştir (Şekil 3.
22).
66
Şekil 3. 22 FnENO’nun seçilen en iyi modelinin görüntüsü
Protein modelinin geometrisinin optimizasyonu (enerji minimizasyonu) AMBER99
forcefield (FF) [69] kullanılarak 250 döngüde yapılmıştır. Bu modelin optimizasyon
öncesi enerji değeri 3390.420505 kcal/mol ve optimizasyon sonrası enerji değeri 8689.888932 kcal/mol’dür.
Validasyon aşamasında ilk olarak ERRAT programı kullanılmıştır. Bu program
oluşturulan protein modelinin üç boyutlu yapısının doğruluğunun atomik bağlar
açısından değerlendirilebilmesini sağlamaktadır.
Şekil 3. 23 Model FnENO’nun ERRAT programı sonucunun görüntüsü.
67
ERRAT programı amino asitlerdeki CC, CN, CO, NN, NO ve OO atomlarının arasındaki
bağlı olmayan atomik etkileşimleri tahmin etmede kullanılmaktadır [70]. Program
çıktısına göre elde edilen grafikte; %95’in üzerinde olan alanlar (daha koyu alanlar)
hatalı olan aminoasitleri göstermektedir (Şekil 3. 23). Optimizasyon öncesi 91.294
olarak elde edilen skor optimizasyon sonrası 94.774 değerine yükselmiştir. Skorun
yüksek olması atomlar arasındaki etkileşimin düzeldiğini ve proteinin üç boyutlu
yapısının optimizasyon sonrası doğruluğunun arttığını göstermektedir.
ProSA programı protein modelinin yapısal kalitesini tespit etmekte kullanılmıştır.
Program çıktı olarak bir Z-skoru ve bir enerji grafiği vermektedir. Z-skoru toplam model
kalitesini ifade etmekte ve tabloda yapısı çözümleniş diğer proteinlerin Z-skoru
değerleriyle birlikte verilmektedir. Eğer ortaya çıkan değer deneysel olarak yapısı
çözümlenmiş proteinlerin Z-skoru değerlerinin dışında çıkarsa protein hatalı olarak
kabul edilmektedir [71]. Yapılan her iki validasyon sonucunda da protein modeli, yapısı
X-ray kristalografisinde çözülmüş proteinler arasında görülmüştür. Optimizasyon
öncesi Z skoru -9.08 (-10.21 EhENO) iken optimizasyon sonrası -9.11 (-10.21 EhENO)
olmuştur. Z-skoru proteinin deneysel olarak yapısı çözümlenen proteinlerin skorları
arasında yer aldığından model doğru olarak kabul edilmiştir (Şekil 3. 24). Enerji
düzeyine bakıldığında ise her iki sonuçta da dizi pozisyonuna göre negatif değerlerde
olduğu görülmüştür (Şekil 3.25). Bu durum model proteinin konformasyonun daha
doğru bir şekilde belirlendiğini göstermektedir. Pozitif değerin olması proteindeki
sorunlu veya hatalı aminoasitlerin varlığını göstermektedir.
Şekil 3. 24 Optimizasyon sonrası FnENO modelinin Z-skor sonucu
68
Şekil 3. 25 Optimizasyon sonrası FnENO modelinin enerji düzeyi grafiği
RAMPAGE programı [72] ile proteinin birincil yapısında bulunan aminoasitlerin ikincil
yapı içerinde hangi pozisyonda bulunduklarını belirlemek amacıyla kullanılan
ramachandran diyagramı oluşturulmuştur. Çıkan sonuçlara göre proteinin üç boyutlu
yapısının kabul edilebilir doğrulukta modellenmiş olduğu görülmektedir. Optimizasyon
öncesi Ramachandran diyagramındaki asıl bölge, kabul edilebilir bölge ve dış bölgedeki
rezidülerin yüzdeleri sırasıyla; %96.3, %3.0, %0.7 iken optimizasyon sonrası yüzdeler
sırasıyla; %94.7, %4.6, %0.7’dir (Şekil 3. 26).
Şekil 3. 26 Optimizasyon sonrası FnENO modelinin Ramachandran diyagramı. Bu
diyagramda asıl bölgeler mavi, kabul edilebilir bölgeler turuncu, dış bölgeler beyaz
olarak gösterilmiştir.
69
SOPMA programı [73] kullanılarak proteinin ikincil yapısı analiz edilmiştir ve bu
programdan elde edilen verilere göre FnENO modelinin ikincil yapısında % 45,73
oranında alfa heliks, % 7,39 oranında beta dönüşü, % 16,17 rastgele döngüler, % 30,72
oranında beta yaprak kısımlarının bulunduğu belirlenmiştir (Şekil 3. 27).
(A)
(B)
Şekil 3. 27 SOPMA programına göre FnENO model proteinin ikincil yapı sonuçları (A)
Proteinin ikincil yapısının aminoasit dizisine göre belirlenen yüzdeleri (B) Proteinin
aminoasit dizinin ikinci yapıda verilen renklere göre sıralanışı.
Modellenmiş proteinin muhtemel ilaç bağlanabilecek cep bölgeleri Q-SiteFinder [74] ve
DoGSiteScorer [75] programları ile belirlenmiştir. Q-SiteFinder programı ile 5 farklı
hedef bölge bulunmuştur (Şekil 3.28). DoGSiteScorer programı ile de 14 farklı hedef
70
bölge belirlenmiştir. DoGSiteScorer programı verilerine göre P0 bölgesinin ilaç skoru
0.88 olarak bulunmuştur ve en iyi ilaç hedef bölgesi olarak seçilmiştir (Şekil 3. 29). P0
bölgesi, Q-SiteFinder programından elde edilen sonuç ile karşılaştırıldığında Bölge 1 ile
aynı olduğu görülmektedir.
Belirlenen cep bölgesinin ilaç skoru 1’e yakın ise ilaç geliştirilmesine daha uygun olduğu
bilinmektedir [75]. Bu nedenle model proteinin cep bölgelerinin ilaç tasarımına uygun
olduğu görülmektedir.
Şekil 3. 28 Model proteinin aktif bölgelerinin Q-SiteFinder görüntüsü. Açık mavi: Bölge
1, açık yeşil: Bölge 2, koyu yeşil: Bölge 3, koyu mavi: Bölge 4, gri: Bölge 5.
Şekil 3. 29 Model proteinin aktif bölgelerinin DoGSiteScorer görüntüsü. Şekilde protein
üzerindeki 14 farklı cep bölgesinin fiziksel özelikleri ve ilaç skoru verilmiştir. Protein
modeli üzerinde en iyi ilaç hedefi olarak belirtilen bölge (P0) açık mavi renkte
gösterilmiştir.
71
3.2.10 F. nucleatum Enolazının Süperimpozisyonlarının Yapılması ve Root-MeanSquare Deviation (RMSD) Değerlerinin Belirlenmesi
FnENO’nun modellenmesi için kullanılan kalıp protein EhENO ile süperimpozisyon
çalışmaları MolSoft-ICM Browser 3.7-2d programı kullanılarak yapılmıştır (Şekil 3. 30)
Şekil 3. 30 FnENO ve EhENO enzimlerinin aminoasit dizilerinin süperimpozisyonu.
Kırmızı: FnENO, Gri: EhENO
Daha sonra Fusobacterium nucleatum’un konağı olan insanın kas, beyin ve akciğer
hücrelerinin enolaz enzimlerinin üç boyutlu yapıları Protein Data Bank [66] tan
bulunmuştur Bu yapılar ile FnENO’nun yapısı eşleştirilmiş ve süperimpozisyonları
MolSoft-ICM Browser 3.7-2d ile yapılmıştır (Şekil 3. 31) Yapılan süperimpozisyon
çalışmalarında insan kas ve beyin hücreleri enolaz enzimlerine ek olarak akciğer hücresi
enolaz enzimi de eklenmiştir. H.sapiens enolaz1 (insan akciğer enolazı)’in gen bankası
kayıt numarası X66610.1’dir.
Root-mean-square deviation (RMSD) değeri SuperPose programı ile belirlenmiştir. İki
protein yapısının kıyaslanması sonucu ortaya çıkan root-mean-square deviation değeri
süperimpozisyonu yapılmış proteinlerin atomları arasındaki uzaklıkları belirlemektedir
[76]. Belirlenen RMSD değerleri de Çizelge 3.7’de gösterilmiştir. RMSD değeri sıfıra ne
kadar yakınsa iki protein birbirine yapısal olarak o kadar benzemektedir. Bu nedenle,
H. sapiens enolaz3 (insan kas spesifik beta enolaz izoform 1) FnENO proteinine en çok
benzeyen protein olarak belirlenmiştir.
72
Şekil 3. 31 Üç farklı insan enolaz dizileri ile FnENO’nun aminoasit dizilerinin
süperimpozisyonları. Kırmızı: FnENO Mavi: HuENOβ (H. sapiens enolaz3 (İnsan kas
spesifik beta enolaz izoform 1)) Yeşil: HuENOγ (H. sapiens enolaz2 (İnsan nöron spesifik
gamma-2 enolaz)) Sarı: HuENOα (H. sapiens enolaz1 (İnsan akciğer enolazı))
Çizelge 3. 7 RMSD değerleri
Global RMSD (Å)
FnENO-HuENOα
FnENO-HuENOβ
FnENO-HuENOγ
RMSD
2.73
2.57
2.82
Eşleşen Atomlar
2756
2763
2773
73
BÖLÜM 4
DEĞERLENDİRME VE ÖNERİLER
Enolaz
enzimi
F.
nucleatum
dahil
her
canlıda
oksijensiz
solunumun
gerçekleştirilebilmesi açısından çok önemli bir enzimdir. Glikolitik yolak üzerinde
pirüvat üretimi sırasında 2- PGA’nın PEP’e dönüşümünü katalizlemektedir [34]. Ayrıca;
bu enzim arkebakteri, öbakteri ve ökaryot canlılar dahil çok çeşitli kaynaklarda
incelenmiş ve yüksek oranda korunmuş olduğu görülmüştür. Bu koruma özellikle
katalitik bölgelerde belirgindir ve çeşitli türlerde benzer kinetik özelliklere sahip
enzimlerin bulunmasına neden olmaktadır [79].
Patolojik açıdan bu enzim değerlendirildiğinde ise fibronektin bağlayıcı aktiviteye sahip
olup bakteri adhezyonuna katkı sağlayabilmektedir. Ayrıca; önemli bir diğer patolojik
özelliği plazminojen bağlayıcı reseptörlere sahip olmasıdır [40], [42]. Yapılan
araştırmalarda
Borrelia
burgdorferi,
Streptococcus
pneumoniae,
Leishmania
mexicana, Pneumocystis carinii gibi çeşitli canlılardaki enolaz enziminin plazminojen
bağlama özelliklerinin olduğu görülmüştür [80], [81], [82]. Elde edilen bu bilgilere göre
F. nucleatum enolaz enziminin de plazminojen bağlama aktivitesine sahip olabileceği
düşünülmektedir.
F. nucleatum’un canlılığını sürdürebilmesi için kritik bir öneme sahip olan enolaz
enziminin
ek
olarak
bu
bakterinin
patogenezinde
de
aktif
rol
oynadığı
düşünülmektedir. Bu nedenle periodontal hastalıklarda geliştirilebilecek yeni tedavi
yöntemleri için bu enzim hedef molekül olarak kullanılabilecektir. Bu tez çalışmasında
F. nucleatum enolaz enziminin literatürde ilk defa gen klonlaması, ifade edilmesi
74
yapılmış ve saf olarak elde edilen enzimin kinetik karakterizasyonu ve homoloji
modellemesi ile yapısal karakterizasyonu yapılmıştır.
F. nucleatum enolazını kodlayan gen dizisinin 1302 baz çiftinden oluştuğu klonlama
sırasında belirlenmiştir. Bu gen bölgesi ekspresyon vektörüne aktarılırken tasarlanan
spesifik primerler sayesinde protein dizisine 6xHis-tag bölgesi eklenmiştir. Eklenen bu
dizi ile birlikte elde edilen protein SDS-PAGE analizinde görüldüğü gibi hücre lizatının
süpernatantında çözünür halde üretilmiş ve saflaştırma sonrasında yapılan aktivite
deneylerinde proteinin aktif olarak elde edildiği belirlenmiştir.
Kinetik karakterizasyon öncesi yapılan optimum pH deneyinde F. nucleatum enolaz
enziminin en yüksek aktivite gösterdiği pH değeri 8,5 olarak belirlenmiştir. Literatür
taraması sonucunda diğer bakteriyel enolazlar ile kıyaslandığında F. nucleatum
enolazının optimum pH değerinin literatürdeki değerlere yakın olduğu görülmüştür.
[38], [39], [83], [84], [85], [86], [87], [88]. Termostabilite deneyinde ise belirlenen
sıcaklık aralıklarında zaman ve sıcaklık artışına göre enzim aktivitesinin düşmesi
beklenmekteydi. Ancak yapılan deneyde 30-600C sıcaklık aralığında beklenene göre çok
daha az bir düşüş görülmüş ve bu sıcaklık aralığında enzimin aktif bir şekilde bulunduğu
belirlenmiştir. Literatürde Brucella abortus enolaz enzimi gibi bu sıcaklık aralığında
aktivitesini koruyabilen enzim türleri mevcuttur [39].
F. nucleatum enolaz enziminin farklı substrat konsantrasyonlarında kinetik analizi
yapılmış ve Grafit 3.0 programı kullanılarak Km ve Vmax değerleri belirlenmiştir.
Hesaplamalara göre bu değerler; Km: 0,4825 mM, Vmax: 0,1587, kcat: 20,38 s-1, kcat/Km:
4,22 x 104 M-1s-1 olarak bulunmuştur. Çizelge 3. 8‘de verilen farklı türlerde bulunan
enolaz enzimlerinin kinetik parametreleri, ilk kez bu çalışma ile belirlenen F. nucleatum
enolaz enziminin kinetik değerleri ile karşılaştırılmıştır. Km değeri diğer türlere göre çok
fazla değişmemektedir ve bu türlere göre belirlenen değer aralığı içerisinde
bulunmaktadır. Vmax değerine bakıldığında türlere göre belirlenen değerler arasında
farklılıkların ve 10-200 kat arasında değişen değerlerin bulunduğu tespit edilmiştir.
75
Çizelge 3. 8 Farklı türlerdeki enolaz enzimlerinin 2-PGA için kinetik değerlerinin
karşılaştırılması
Enzim Kaynağı
Km (mM)
Vmax
pH
Kaynak
Kaynak
Tarihi
Thermotoga
maritima
0.07 - 0.03
-
pH 7-8
[83]
1995
E.coli
0,1
-
pH 8,1
[84]
1971
Desulfovibrio
vulgaris
0,136
-
pH 8.0
[38]
2004
Bacillus subtilis
0.67
-
pH 8.1–
8.2
[85]
1998
pH 8.5
[39]
2012
pH 7.0
[86]
2009
pH 6.8
[87]
2006
pH 7.0
[88]
2007
pH 8,5
Bu
çalışmada
2013
Brucella abortus
A19
Streptococcus
suis
Leuconostoc
mesenteroides
Streptococcus
mutans
Fusobacterium
nucleatum
2,0
2,47
2.61
9,5
0,4825
0,178
mM.l-1.min-1
2.32
mM. l-1.min-1
2.91
mM.min-1.mg-1
31.0
mM.min-1.mg-1
0,1587
Son olarak; F. nucleatum enolaz enziminin homoloji modellemesi yapılarak proteinin üç
boyutlu yapısı belirlenmiştir. Üç boyutlu yapısının belirlenmesi ile birlikte bu proteini
inhibe edebilmek için ilaç bağlanabilecek muhtemel cep bölgeleri belirlenmiştir.
Yapılan bu çalışmalar ile ileride F. nucleatum enolaz enzimi hedef olarak seçilebilecek
ve yeni ilaç tasarımları için bu bölgeler kullanılabilecektir.
F. nucleautum’un konağı olan Homo sapiens enolaz dizileri ile eşleştirmeler yapılmış ve
süperimpoziyonları belirlenmiştir. Yapılan çalışmalar ile konak ile bakteri enolazı
arasındaki farklılıklar belirlenmiş ve hedef olarak seçilebilecek bölgeler bulunmuştur.
Bu tez çalışması ile FnENO proteininden elde edilen sonuçların kullanılmasıyla;
-Konak ve bakteri enolazı ile yapılan eşleştirmeler göz önüne alınarak; FnENO enziminin
belirlenen aminoasit dizisi farklılıkların aktiviteye ne derece etki ettiğinin çalışılması ve
inhibitör çalışmalarında hedef bölge olarak kullanılabilecek dizilerin belirlenmesi
-Moleküler docking ile inhibitör çalışmalarının yapılması ve elde edilen inhibitörlerin
enzimin aktivitesi üzerindeki rölünün belirlenmesi
76
- Yeni ilaç tasarımına yönelik olarak proteinin, inhibitörler ile etkileştirilmesi ve in vivo
çalışmalarının yapılması
- Enolazın fibronektin bağlayıcı ve plazminojen bağlayıcı reseptör özelliği incelenerek F.
nucleatum’un koloni oluşturması, hücrelere adhezyonu ve immün yanıta olan etkileri
ile ne derecede ilişkili olduğunun araştırılması önerilmektedir.
77
KAYNAKLAR
[1]
Orbak, R. ve Zihni, M., (2006), “Periodontal Hastalığın Başlangıç Tedavisi,
Karşılaşılan Komplikasyonlar ve Bu Komplikasyonların Giderilme Stratejileri”,
Atatürk Üniv. Diş Hek. Fak. Derg. 16:3, 33-41
[2]
Albandar, J. M., (2002), “Global Risk Factors and Risk İndicators For
Periodontal Diseases”, Periodontology 2000, 29, 177–206
[3]
Armitage, G. C., (2004), “Periodontal Diagnoses and Classification of
Periodontal Diseases” Periodontology 2000, 34, 9-21
[4]
Hatem, A. E., (2012). “Epidemiology and Risk Factors of Periodontal Disease,
Periodontal Diseases – A Clinician's Guide, Dr. Jane Manakil” (Ed.), ISBN: 978953-307-818-2, InTech.
[5]
Van Dyke, T. E. ve Dave, S., (2005), “Risk Factors for Periodontitis”, J Int Acad
Periodontol; 7(1): 3–7.
[6]
Löe, H., Theilade, E. ve Jensen, SB., (1965). “Experimental gingivitis in man”
Journal of Periodontology, 36: 177-187.
[7]
Genco, R. J. ve Borgnakke, W. S., (2013). “Risk factors of Periodontal Disease”
Periodontology 2000, 62: 59–94.
[8]
Dye, B.A., (2012). “Global Periodontal Disease Epidemiology”, Periodontology
2000, 58: 10–25.
[9]
Peterson, P.E. ve Ogawa, H., (2005). “Strengthening the Prevention of
Periodontal Disease: The WHO Approach”, J. Periodontol., 76(12): 2187-2193.
[10]
Petersen, P. E., (2003). “The World Oral Health Report 2003: continuous
improvement of oral health in the 21st century–the approach of the WHO
Global Oral Health Programme.” Community Dentistry and Oral
Epidemiology, 31(s1): 3-24.
[11]
AAP Board of Trustees, (2011). “Comprehensive Periodontal Therapy: A
Statement by the American Academy of Periodontology”, J Periodontol.,
82(7): 943-949.
[12]
Efeoğlu,
A.,
“Periodontal
Kemik
Cerrahisi”,
http://www.istanbul.edu.tr/dishekimligi/dersnotlari/Periodontal_Kemik_Cerr
ahisi.pdf, 14 Kasım 2013.
78
[13]
Bolstad, A. I., Jensen, H. B. ve Bakken, V., (1996). “Taxonomy, Biology, and
Periodontal Aspects of Fusobacterium nucleatum”, Clinical Microbiology
Reviews, 9(1): 55–71.
[14]
Al-Haroni, M., Skaug, N., Bakken, V. ve Cash, P., (2008). “Proteomic analysis of
ampicillin-resistant oral Fusobacterium nucleatum.” Oral Microbiol Immunol,
23: 36–42.
[15]
Kapatral, V., Anderson, I. ve Ivanova N., (2002). “Genome Sequence and
Analysis of the Oral Bacterium Fusobacterium nucleatum Strain ATCC 25586”,
Journal Of Bacteriology, 184(7): 2005–2018.
[16]
Karpathy, S. E., Qin, X., Gioia, J., Jiang, H. Y., Liu, Y., Petrosino, J. F.,
Yerrapragada, S., Fox, G. E., Kinder Haake, S., Weinstock, G. W. ve Highlande,
S. K., (2007). “Genome Sequence of Fusobacterium nucleatum Subspecies
Polymorphum — a Genetically Tractable Fusobacterium.” PLoS ONE, 2:8,
e659.
[17]
Signat, B., Roques, C., Poulet, P. ve Duffaut, D., (2011). “Role of Fusobacterium
nucleatum in Periodontal Health and Disease”, Curr. Issues Mol. Biol., 13: 2536.
[18]
Han, Y. W., Shi, W., Huang, G. T.-J., Kinder Haake, S., Park, No-H., Kuramıtsu,
H. ve Genco, R. J., (2000). “Interactions between Periodontal Bacteria and
Human Oral Epithelial Cells: Fusobacterium nucleatum Adheres to and Invades
Epithelial Cells”, Infection And Immunity, 68(6): 3140–3146.
[19]
Dabija-Wolter, G., Sapkota, D., Cimpan, M. R., Neppelberg, E., Bakken, V. ve
Costea, D. E., (2012). “Limited in-depth invasion of Fusobacterium nucleatum
into in vitro reconstructed human gingiva”, Archives of Oral Biology, 57: 344 –
351.
[20]
Gaetti-Jardim Júnior, E., Rui Luvizotto, M. C. ve Avila-Campos, M. J., (2000).
“Virulence of Oral Fusobacterium nucleatum from Humans And Non-Human
Primates in Mice”, Brazilian Journal of Microbiology, 31: 146-150.
[21]
Haraldsson, G., (2005). “Oral commensal Prevotella species and
Fusobacterium nucleatum: Identification and potential pathogenic role.”,
Faculty of Medicine of the University of Helsinki, Helsinki.
[22]
Bradshaw, D. J., Marsh, P. D., Watson, G. K. ve Allison, C., (1998). “Role of
Fusobacterium nucleatum and Coaggregation in Anaerobe Survival in
Planktonic and Biofilm Oral Microbial Communities during Aeration”, Infection
And Immunity, 66(10): 4729-4732.
[23]
Kremer, B. H.A. ve Martijn van Steenbergen, T.J., (1999). “Peptostreptococcus
micros coaggregates with Fusobacterium nucleatum and non-encapsulated
Porphyromonas gingivalis”, FEMS Microbiology Letters, 182: 57-61.
[24]
Chew, J., (2010). “Protein expression in Fusobacterium nucleatum ATCC 10953
Biofilm Cells Induced by an Alkaline Environment”, The degree of Doctor of
Philosophy, The University Adelaide, South Australia.
79
[25]
Settem, R. P., Taher El-Hassan, A., Honma, K., Stafford, G. P. ve Sharmaa, A.,
(2012). “Fusobacterium nucleatum and Tannerella forsythia Induce Synergistic
Alveolar Bone Loss in a Mouse Periodontitis Model”, Infection and Immunity,
80(7): 2436–2443.
[26]
Han, Y. W., Ikegami, A., Rajanna, C., Kawsar, H. I., Zhou, Y., Li M., Sojar, H. T.,
Genco, R. J., Kuramitsu H. K. ve Deng C. X., (2005). “Identification and
Characterization of a Novel Adhesin Unique to Oral Fusobacteria”, Journal Of
Bacteriology, 187(15): 5330–5340.
[27]
Afra, K., Laupland, K., Leal, J., Lloyd, T. ve Gregson, D., (2013). “Incidence, risk
factors, and outcomes of Fusobacterium species bacteremia”, BMC Inf.
Dis., 13(1): 264.
[28]
Avila-Campos, M. J.,, Rivera, I. N. ve Nakano, V., (2006).“Genetic diversity of
oral Fusobacterium nucleatum isolated from patients with different clinical
conditions”, Rev. Inst. Med. trop. S. Paulo, 48(2): 59-63.
[29]
Arat, Y.O., Shetlar, D.J. ve Rose, J.E., (2004). “Blindness From Septic
Thrombophlebitis Of The Orbit And Cavernous Sinus Caused by Fusobacterium
nucleatum”, Arch Ophthalmol, 122:652–654.
[30]
Han, Y.W., Fardini, Y., Chen, C., Lacampo, K.G., Peraino, V.A., Shamonki, J.M.
ve Redline, R.W., (2010). “Term stillbirth caused by oral Fusobacterium
nucleatum”, Obstet. Gynecol., 115:442–445.
[31]
Castellarin, M., Warren, R.L., Freeman, J.D., Dreolini, L., Krzywinski, M.,
Strauss, J., Barnes, R., Watson, P., Allen-Vercoe, E., Moore, R.A. ve Holt, R.A.,
(2012). “Fusobacterium nucleatum infection is prevalent in human colorectal
carcinoma”, Genome research, 22: 299-306.
[32]
Kostic, A.D., Gevers, D., Pedamallu, C.S., Michaud, M., Duke, F., Earl, A.M.,
Ojesina, A.I., Jung, J., Bass, A.J., Tabernero, J., Baselga, J., Liu, C., Shivdasani,
R.A., Ogino, S., Birren, B.W., Huttenhower, C., Garrett, W.S. ve Meyerson, M.,
(2012). “Genomic analysis identifies association of Fusobacterium with
colorectal carcinoma”, Genome research, 22: 292-298.
[33]
Nyfors, S., Kononen, E., Syrjanen, R., Komulainen, E. ve Jousimies-Somer, H.,
(2003). “Emergence of penicillin resistance among Fusobacterium
nucleatum populations of commensal oral flora during early childhood”, J.
Antimicrob. Chemother., 51:107–12.
[34]
Pancholi V., (2001). “Multifunctional α -enolase: its role in diseases”, Cell. Mol.
Life Sci., 58, 902–920.
[35]
Capello, M., Ferri-Borgogno, S., Cappello, P. ve Novelli, F., (2011). “α-enolase:
a promising therapeutic and diagnostic tumor target,” FEBS Journal, 278(7):
1064–1074.
[36]
Diaz-Ramos A., Roig-Borrellas A., Garcia-Melero A. ve Lopez-Alemany R.,
(2012). “alpha-Enolase, a multifunctional protein: its role on
pathophysiological situations”. J Biomed Biotechnol 2012: 156795. doi:
10.1155/2012/156795.
80
[37]
Pelicano, H., Martin, D.S., Xu, R.H. ve Huang, P., (2006). “Glycolysis inhibition
for anticancer treatment”. Oncogene, 25: 4633–4646.
[38]
Kitamura, M., Takayama, Y.,Kojima, S., Kohno, K., Ogata, H., Higuchi, Y. ve
Inoue, H., (2004). “Cloning and expression of the enolase gene from
Desulfovibrio vulgaris (Miyazaki F)”, Biochim. Biophys. Acta, 1676:172–181.
[39]
Han, X., Ding, C., Chen, H., Hu, Q. ve Yu, S., (2012). “Enzymatic and biological
characteristics of enolase in Brucella abortus A19”, Mol Biol Rep., 39(3): 270511.
[40]
Esgleas, M., Li Y., Hancock, M.A., Harel, J., Dubreuil, J.D. ve Gottschalk,
M., (2008). “Isolation and characterization of alpha-enolase, a novel
fibronectin-binding protein from Streptococcus suis”, Microbiology 154: 2668–
2679.
[41]
Sha, J., Erova, T.E., Alyea, R.A., Wang, S., Olano, J.P., Pancholi, V. ve Chopra,
A.K., (2009). “Surface-expressed enolase contributes to the pathogenesis of
clinical isolate SSU of Aeromonas hydrophila”, J. Bacteriol., 191:3095–3107.
[42]
Redlitz, A., Fowler, B.J., Plow, E.F. ve Miles, L.A., (1995). “The role of an
enolase-related molecule in plasminogen binding to cells”, Europ. J.
Biochem., 227: 407–415.
[43]
Promega, pGEM®-T and pGEM®-T Easy Vector Systems Technical Manual,
http://www.promega.co.uk/resources/protocols/technical-manuals/0/pgemt-and-pgem-t-easy-vector-systems-protocol/, 15 Nisan 2013.
[44]
Thermo Scientific, aLICator Ligation Independent Cloning and Expression
System, http://www.thermoscientificbio.com, 02 Mayıs 2013.
[45]
The National Center for Biotechnology Information (NCBI), Nucleotide
sequence, http://www.ncbi.nlm.nih.gov/, 16 Nisan 2013.
[46]
Sambrook, J. ve Russell, D.W., (2001), Molecular Cloning A Laboratory Manual
I-II-III, Third Edit., CSHL Press, New York.
[47]
Promega, Wizard® SV Gel and PCR Clean-Up System Technical Bulletin,
http://www.promega.co.uk, 26 Nisan 2013.
[48]
QIAGEN, QIAprep®Miniprep Handbook, 2009, Cat. No: 27104, Germany.
[49]
Promega, Wizard® Plus SV Minipreps DNA Purification System Technical
Bulletin, https://www.promega.com, 02 Nisan 2013.
[50]
Align Sequences using ClustalW2 EBI, Multiple Sequence Alignment,
http://www.ebi.ac.uk/Tools/msa/clustalw2, 17 Nisan 2013.
[51]
Akat, A., (2010). Theileria annulata’nın enolaz enzimini kodlayan genin ilaç ve
aşı tasarım çalışmalarında kullanılmak üzere izolasyonu, klonlanması ve analiz
edilmesi, Yüksek Lisans Tezi, YTÜ, Fen Bilimleri Ens., İstanbul.
[52]
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. ve Kumar, S.,
(2011) “MEGA5: Molecular Evolutionary Genetics Analysis using Maximum
Likelihood, Evolutionary Distance, and Maximum Parsimony Methods.”
Molecular Biology and Evolution 28: 2731-2739.
81
[53]
Shoemark, DK., (2000). The kinetic characterization of the lactate
dehydrogenase enzyme from Plasmodium falciparum, Doctor of philosophy
thesis, Department of biochemistry, University of Bristol, Bristol.
[54]
Laemmli, U.K., (1970). "Cleavage of structural proteins during the assembly of
the head of bacteriophage T4", Nature, 227: 680-685.
[55]
Qiagen, QIAexpressionist: A handbook for high-level expression and
purification
of
6xhis-tagged
proteins,
http://kirschner.med.harvard.edu/files/protocols/QIAGEN_QIAexpressionist_
EN.pdf, 20 Mayıs 2013.
[56]
Peptide Properties Calculator- Northwestern University, Peptide property
calculator, http://www.basic.northwestern.edu/biotools/proteincalc.html, 20
Mayıs 2013.
[57]
Grimsley, G.R. ve Pace, C.N., (2003). Current Protocols in Protein Science,
John Wiley and Sons. Inc., New Jersey.
[58]
Pal-Bhowmick, I., Sadagopan, K., Vora, HK., Sehgal, A., Sharma, S. ve Jarori
GK., (2004). “Cloning, Over-Expression, Purification and Characterization of
Plasmodium falciparum Enolase”, Eur. J. Biochem., 271: 4845-4854.
[59]
Kushwaha, S., Singh, P. K., Rana, A. K. ve Misra-Bhattacharya, S., (2011).
“Cloning, expression, purification and kinetics of trehalose-6-phosphate
phosphatase of filarial parasite Brugia malayi”, Acta tropica, 119(2): 151-159.
[60]
Enzyme kinetics, Chapter 10, http://www.uscibooks.com/changten.pdf, 21
Kasım 2013.
[61]
Rogers A. and Gibon Y., (2009). “Enzyme kinetics: theory and practice.”
In plant metabolic Networks (pp. 71-103). Springer New York.
[62]
Walsh, R., “Alternative Perspectives of Enzyme Kinetic Modeling.”,
http://cdn.intechopen.com/pdfs/36518/InTechAlternative_perspectives_of_enzyme_kinetic_modeling.pdf, 22 Kasım 2013.
[63]
Leatherbarrow, R.J., (1992). "GraFit Version 3.0", Erithacus Software Ltd.,
Staines, UK.
[64]
Bishop Taştan A. Ö., Beer, T. A. P. ve Joubert, F. (2008). “Protein homology
modelling and its use in South Africa”. South African Journal of Science, 104:
1-2, 2-6.
[65]
NCBI,PSI Blast, http://blast.ncbi.nlm.nih.gov/Blast.cgi, 5 Kasım 2013.
[66]
ProteinDataBank, X-ray Resolution, http://www.rcsb.org/pdb, 6 Kasım 2013.
[67]
Align Sequences using Clustal Omega EBI, Multiple Sequence Alignment,
http://www.ebi.ac.uk/Tools/msa/clustalo/, 7 Kasım 2013.
[68]
Eswar, N., Marti-Renom, M. A., Webb, B., Madhusudhan, M. S., Eramian D.,
Shen, M., Pieper, U. ve Sali, A., (2006). “Comparative Protein Structure
Modeling With MODELLER. Current Protocols in Bioinformatics”, John Wiley &
Sons, Inc., Supplement 15, 5.6.1-5.6.30.
82
[69]
HyperChem molecular modeling, Homology modelling for HyperChem,
http://www.molfunction.com/software1.htm, 11 Kasım 2013.
[70]
Colovos C. ve Yeates TO., (1993), “Verification of protein structures: patterns
of nonbonded atomic interactions.”, Protein Sci., 2(9):1511-9.
[71]
Wiederstein M. ve Sippl M. J., (2007). “ProSA-web: interactive web service for
the recognition of errors in three-dimensional structures of proteins”, Nucleic
Acids Research, 35: 407–410.
[72]
Lovell, S. C., Davis, I. W., Arendall III W. B., de Bakker P. I. W., Word J. M.,
Prisant M. G., Richardson, J. S. ve Richardson, D. C., (2003), “Structure
Validation by Cα Geometry: φ, ψ and Cβ Deviation”, PROTEINS: Structure,
Function, and Genetics, 50:437–450.
[73]
Geourjon, C. ve Deléage, G., (1995). “SOPMA: Significant improvement in
protein secondary structure prediction by consensus prediction from multiple
alignments.”, Cabios 11, 681-684.
[74]
Q-SiteFinder, Faculty of Biological Sciences, University
http://www.modelling.leeds.ac.uk/qsitefinder/, 13 Kasım 2013.
[75]
Volkamer, A., Kuhn, D., Grombacher, T., Rippmann, F. ve Rarey, M., (2012).
“Combining global and local measures for structure-based druggability
predictions. “ J. Chem. Inf. Model.”,52: 360-372.
[76]
Maiti, R., Van Domselaar G. H., Zhang H. ve Wishart D. S., (2004) "SuperPose:
a simple server for sophisticated structural superposition" Nucleic Acids Res.
1; 32 (Web Server issue): W590W594.
[77]
Hansen L.H., Knudsen S. ve Sorensen S.J., (1998). “The effect of the lacY gene
on the induction of IPTG inducible promoters, studied in Escherichia
coli and Pseudomonas fluorescens”, Curr. Microbiol., 36: 341-347.
[78]
Hosaka T., Meguro T., Yamato I. ve Shirakihara Y., (2003). “Crystal structure
of Enterococcus hirae enolase at 2.8 A resolution”, J Biochem., 133(6):817-23.
[79]
Hannaert, V., Albert, M. A., Rigden, D. J., Theresa da Silva Giotto, M.,
Thiemann, O., Garratt, R. C., Roy, J. V., Opperdoes F. R. ve Michels, P. A. M.,
(2003). “Kinetic characterization, structure modelling studies and
crystallization of Trypanosoma brucei enolase.” European Journal of
Biochemistry, 270(15): 3205-3213.
[80]
Vanegas, G., Quiñones, W., Carrasco-López, C., Concepción, J. L., Albericio, F.
ve Avilán, L. (2007). “Enolase as a plasminogen binding protein in Leishmania
mexicana.” Parasitology research, 101(6): 1511-1516.
[81]
Fox, D., ve Smulian, A. G. (2001). “Plasminogen-binding activity of enolase in
the opportunistic pathogen Pneumocystis carinii.” Medical Mycology, 39(6),
495-507.
[82]
Toledo, A., Coleman, J. L., Kuhlow, C. J., Crowley, J. T. ve Benach, J. L. (2012).
“The enolase of Borrelia burgdorferi is a plasminogen receptor released in
outer membrane vesicles.” Infection and immunity, 80(1): 359-368.
83
of
Leeds,
[83]
Schurig, H., Rutkat, K., Jaenicke, R. ve Rachel, R. (1995). “Octameric enolase
from the hyperthermophilic bacterium Thermotoga maritima: purification,
characterization, and image processing.” Protein Science, 4(2): 228-236.
[84]
Spring, T. G. ve Wold, F. (1971). “The purification and characterization of
Escherichia coli enolase.” Journal of Biological Chemistry, 246(22): 6797-6802.
[85]
Brown, C. K., Kuhlman, P. L., Mattingly, S., Slates, K., Calie, P. J. ve Farrar, W.
W. (1998). “A model of the quaternary structure of enolases, based on
structural and evolutionary analysis of the octameric enolase from Bacillus
subtilis.” Journal of protein chemistry, 17(8): 855-866.
[86]
Feng, Y., Pan, X., Sun, W., Wang, C., Zhang, H., Li, X., Ma, Y., Shao Z., Ge, J.,
Zheng, F., Gao, G., F. ve Tang, J. (2009). “Streptococcus suis enolase functions
as a protective antigen displayed on the bacterial cell surface.” Journal of
Infectious Diseases, 200(10): 1583-1592.
[87]
Lee, J. H., Kang, H. K., Moon, Y. H., Cho, D. L., Kim, D., Choe, J. Y., Honzatko R.
ve Robyt, J. F. (2006). “Cloning, expression and characterization of an
extracellular enolase from Leuconostoc mesenteroides.” FEMS microbiology
letters, 259(2): 240-248.
[88]
Jones, M. N. ve Holt, R. G. (2007). “Cloning and characterization of an αenolase of the oral pathogen Streptococcus mutans that binds human
plasminogen.” Biochem. Biophys. Res. Commun., 364(4): 924-929.
84
ÖZGEÇMİŞ
KİŞİSEL BİLGİLER
Adı Soyadı
: Sinem YAKARSÖNMEZ
Doğum Tarihi ve Yeri
: 20.12.1990 -EMİNÖNÜ
Yabancı Dili
: İngilizce
E-posta
: [email protected]
ÖĞRENİM DURUMU
Derece
Alan
Okul/Üniversite
Mezuniyet Yılı
Lisans
Biyomühendislik
Yıldız Teknik Üniversitesi
2012
Lise
Sayısal (Fen-Matematik) Gazi Anadolu Lisesi
2008
YAYINLARI
Bildiri
1. Yakarsonmez S, Cayır E, Sarıyer E, Milward MR, Cooper PR, Turgut-Balik D. (2013).
Cloning and sequence analysis of enolase gene from Fusobacterium nucleatum. , 2nd
International Congress of Molecular Biology Association of Turkey, Istanbul, Turkey,
22-23 November 2013.
85
Download
Random flashcards
Merhaba

2 Cards oauth2_google_861773e1-0890-4522-834a-6a5babb58e76

qweeqwqwe

5 Cards oauth2_google_78146396-8b44-4532-a806-7e25cc078908

KIRIHAN GÜMÜŞ DEDEKTÖR

6 Cards oauth2_google_49cd8e53-7096-4be6-ba73-4ff7e4195b4b

Create flashcards