S.No. Miktarı Malın/Hizmetin Cinsi Teknik Şartname 1 10 ADET Taq

advertisement
S.No.
1
Miktarı
10 ADET
Malın/Hizmetin Cinsi
Taq DNA polimeraz enzimi 5 U/µL
2
3 ADET
dNTP Set 100mm (dATP, dGTP, dCTP, dTTP)
3
2 ADET
DNA Ladder 100bp, 50ug
4
700
ADET
HB-OGO02U Primer (Thermo marka,DNA unmodified
HPLCpure,(0,2µmol)
Teknik Şartname
1. Konsantrasyonu 5 ünite/μl
olamlıdır.
2. 500 ünitelik ambalajlarda
olmalıdır.
3. Taq DNA polimerazın yanında
ayrı tüplerde (NH4)2SO4 içeren
10X buffer A ve 50 mM MgCl2
ve 500 mM KCl içeren 10X
buffer S verilmelidir.
4. MgCl2 buffer solüsyonu 50
mM'dan az olamamalıdır.
5. Enzimin yarı ömrü 95 °C'de 40
dakikadan daha uzun olmalıdır.
6. Mg++ varlığında 5' den 3' ne
nükleotid ekleyebilmeli ve 5' den
3' ne ekzonükleaz aktivitesi
olmalıdır.
7.
20
kb'a
kadar
PCR
amplifikasyonu yapabilmelidir.
8. Ürün ilgili laboratuarda
denenmiş ve optimum sonuçlar
alınmış olmalıdır.
10 mM yoğunlukta her bir
ambalajda 1’er ml’lik 5 tüp
olacak, Ürün Fermentas muadili
olmalıdır
1.
Moleküler
çalışmalarda
kullanıma uygun olmalı
2. Jel elektropforez agaroz ve
polyakrilamid
çalışmalarında
kullanıma uygun olmalı
3. PCR ürünlerinin ve çift sarmal
DNA
fragmentlerinin
yürütülmesine uygun olmalı.
4. Kullanıma hazır olmalı.
5.
Yükleme
solüsyonu
Bromophenol
Blue,
Xylene
Cyanol ve Orange G boyaları
içermelidir.
6. Ürün 100 bp - 1000 bp dahil en
az 10 adet bant vermelidir.
7. 50 μg olmalıdır.
8.
Ürün
daha
önce
laboratuvarımızda denenmiş olup,
optimum
sonuçlar
alınmış
olmalıdır.
1-Nükleotit
sentez
aralığı
0,2umol olmalıdır.
2-HPLC metodu ile saflaştırılmış
olmalıdır
3-Ürün liyofilize halde teslim
edilmeli.
4-Primer
üretim
sertifikasıyla
birlikte teslim edilmeli.
T1-Fo r wa r d: AACGGATGAAGAAGGAAAACG
Re v e r se: ATATTGGGCAGTGTCCACACA
T1EX-Forwar d: AACGGATGAAGAAGGAAAACGAAG
Re v e r se: ATATTGGGCAGTGTCCACACAAAA
EX1_C170I-Fo r wa r d: TTGGCTCTCAAAAAGGAAA
Re v e r se: CCCTCACAATTTTCCTCCAA
M3a -Fo r wa r d: GAATTCAAGGAAAGTTTTATATAT
Re v e r se: ATTCTTCATAACTTCGATTAA
M3A Fo r wa r d: GAATTCAAGGAAAGTTTTATAGAT
Re v e r se: AATCTTCATAACTTCGATTAA
CAPS-DdeI -For wa r d: GCCCAACCTTCAACTCGATA
Re v e r se: TTGAATCTCATTTTTCTGTTGCAT
Fom1-R-Forward:ATGAGTTTTTGATAGTTTCATAAG
Fom1-S- Re v e r se: GAACACTCCCTTAGATACTT
AM -Fo r wa r d: CTTCATCACTATTCGAGGATGAC
Re v e r se: CTTTCTGCACACCAACCAAAAGG
FM -For wa r d: GAAGATGCAAAGAAAAAGAGAAGG
5
Pr ime r
Re v e r se: TCAATTATTAAACATTCTGATGCC
CAPS2-Fo r wa r d: GGAAGTGAGGTGTTGAATT
Re v e r se: TACACATTGGTCCGTTAGAC
CAPS3-Fo r wa r d: AGACGTAGCATTGCTTCTCTAG
Re v e r se: TGGCATCCTTCAGCACCTTC
Fom2-R408-For wa r d: GAGAAATTTGCAATGGGTGG
Re v e r se: TTACACTATTATTGCTCAACTTGC
Fom2-S342-Forward:
ATGAAAAGAAAAGATAACGACGA
Re v e r se: ATTGCTCTAAGTTGATCATATTCTG
SCAPBO5-1-Forward: AACGCGCAACTTGATACAAATATA
SCAP05-2- Reverse:AACGCGCAACAATAGAAGAACATC
SCOPE14-1-Forward:TGCGGCTGAGGACGGTTGGAGGTC
SCOPE14-2-Reverse:TGCGGCTGAGCATTCTCGAGCAG
6
1 PAKET
10 ul'lik pipet ucu 1000 adet/paket
-DNA az-RNA az free olmalıdır
-Steril olmalıdır ,Eppendorf ve
Thermo mikropipetler ile uyumlu
olmalıdır,
-Ürün daha önce laboratuvarda
denenmiş olmalıdır.
7
2 PAKET
200 ul'lik pipet ucu 1000 adet/paket
8
2 PAKET
1000 ul'lik pipet ucu 1000 adet/paket
9
2 PAKET
Ependorf tüp (2 ml'lik)
10 2 ADET
Red Gel (0.5ml)
11 1 PAKET
Non-skirted full profile 96 Well PCR Plate, 50 ad/pk
12 1 PAKET
2 mm Thick Plate Sealing Tape, 10seal/pk
13 2 PAKET
Eldiven
14 1 LT
15 3 ADET
Isoamyl Alcohol
Kloroform (1LT)
RNAaz ve DNAaz free olacak
1000
adetlik
poşetlerde
otoklavlanmaya dayanıklı ve
Laboratuvarımızda
bulunan
otomatik pipetle (Ependorf ve
Thermo marka) uyumlu olacaktır.
RNAaz ve DNAaz free olacak
1000
adetlik
poşetlerde
otoklavlanmaya dayanıklı ve
Laboratuvarımızda
bulunan
otomatik pipetle (Ependorf ve
Thermo marka) uyumlu olacaktır.
1000 adetlik poşetlerde olacak,
tüpler RNAaz ve DNAaz free
olacak,
-80’e
dayanıklı,
otoklavlanmaya dayanıklı ve
kapakları buharlaşmayı önleyici
şekilde olacak.
1-Agaroz jel elektroforezinde
nükleik asitlerin floresan olarak
belirlenmesini sağlamalıdır.
2- Moleküler çalışmalara uygun
olmalıdır.
3- İnsan sağlığına uygun olup
toksik bileşenler içermemelidir.
4- Oda sıcaklığında ışık almayan
ortamlarda saklanabilmelidir.
5Ürün
daha
önce
laboratuvarımızda denenmiş olup
optimum
sonuçlar
alınmış
olmalıdır.
0 , 2ml 9 6well non- skirted plate
uygun olmalıdır. Şeffaf sert
sertifikalı paketlenmiş şekilde
teslim edilmelidir.
S
ebatlarında,
laboratuvar eldiveni.
pudrasız
1 lt’lik şişede, Merk ve muadili
1.Konsantrasyonu 20 mg/ml
olmalıdır.
2.
Denature
edici
ajanlar
varlığında da aktif olmalı.
16 1 ADET
17 1 ADET
RNase A
EcoRI (10 U/µL), 5000 Units
3. 6,5-9,5 pH değerleri arasında
aktif olmalı.
 -20 DERECEDE OLMALIDIR
 5000 ÜNİT OLMALIDIR
 50 m M TRİS HCL PH 7,5 – 10
MM MGCL 2 – 100 MM NACL
0,02 % TRİTON X-100 0,1
MG/ML BSA
 -20 DERECE
 ÜRÜNLER 2 YIL MİADLI
OLMALIDIR
18 1 ADET
Eco32I (EcoRV) (10 U/µL), 2000 Units
19 1 ADET
HindIII (10 U/µL), 5000 Units
20 1 ADET
21 1 ADET
22 1 ADET
MluI (10 U/µL), 1000 Units
XbaI (10 U/µL), 1500 Units
BseMII (BspCNI) (1 U/µL), 100 Units
23 1 ADET
HpyF3I (DdeI) (10 U/µL), 500 Units
1.10 U/µL konsatrasyonda
2.-20 de saklanmalıdır.Teslimatı
soğuk zincirde yapılmalıdır.37
derecede kesim yapabilmelidir.
1- Konsantrasyonu 5 u/?l şeklinde
olmalıdır.
100
reaksiyonluk
olarak 100 µl hacimde olmalıdır.
2- Enzim, içerisinde ayrıca 1 ml
10X fast digest ve 1 ml 10 x fast
digest
green
tamponu
verilmelidir.
3- 1µg plasmid, lambda ve
genomik DNA için 5-10 dakika
arasında sindirimi sağlamalıdır.
45'...?C
A
T
G?_3'
3'...?G T A C? ...5' şeklinde kesim
yapmalıdır.
5- Ürün miyadı en az 12 ay
olmalıdır.
6- Ürünler bölüm tarafından
peyderpey
istenecektir.
Son
kullanma
tarihleri
yaklaşan
ürünler firma tarafından yenisiyle
değiştirilecektir.
7- -20OC de sevk edilmelidir.
1.Desul fov ibrio
desulfuricans’tan izole edilmiş
olmalıdır.
2.Enzim kesim bölgesi C*/TNAG
olmalıdır. GANT*/C
3. 500 ünitelik ambalajlarda
olmalıdır.
4.Konstrasyonu 10 U/µL
olmalıdır.
Download
Random flashcards
canlılar ve enrji ilişkileri

2 Cards oauth2_google_d3979ca9-59f8-451c-9cf7-08c5056d5753

Create flashcards