ASTIMDA GENETİK
ÇALIŞMALAR
Dr. Ömer KALAYCI
Hacettepe Üniversitesi Tıp Fakültesi
Mendelian – Kompleks Hastalıklar
Mendelian
• Kistik fibrozis
• Nadir
• Tek gen
• Ağır mutasyonlar
• Büyük fenotipik efekt
Kompleks
• Astım, allerji
• Sık
• Birçok gen
• Hafif mutasyonlar
• Küçük fenotipik etki
Genler
Genler
Çevre
Astım
ASTIM İLE İLİŞKİLİ
GENLERİN ARAŞTIRILMASI
METODLAR
astım genlerinin araştırılması (I)
Aday gen çalışmaları
Aday gen çalışmaları
• Bilinen SNP lerin tanımlanması
• Tanımlanmamaış SNP lerin bulunması
5'
Exon 1
Yabanıl tip
Mutant tip
Intron 1
Exon 2
Intron 2
Exon 3
3'
TGTTAGGGCCCCCCTCCCTGAA
TGTTAGGGTCCCCCTCCCTGAA
-159
AGGGTCACACAGCTTGTTAGTGACACCTGGAA
T
CTGGAACAAAGATTGCTCATCTCCTTTCCTCGT
TCACCTTTCTTGCTGTTCTGGGCTGACCTTCTCT
GCCTCCTCCAGCTCAGCCCAGCTTCTGTCTCGG
TACCGACCTCGGCC GGCC GGCC GGCCTTATG
GCAGCAGTCATTGCTGTCACCCGCTCTGCCCAG
GCTGCCCGCCAGGTCCACTTATGCCGAGGAGT
CTTCCCCTTGCTTTACCGTGAACCTCCAGAAGC
CATCTGGGCAGATGATGTAGATCGCCGGGTGC
AATTTGGCATTGAAAGTGGTGAGCTACCTAGA
CCTTCCCTGCCACTCCTACCATTTGTATCAGGA
GCCCCCCAACCCAGCTTCCCATACCCACTCAAA
GGGCCTTGCCT CTCTCCTGTG GTCCCAGGTT
TTCCCTGTGA GAGTCACTAA
X geninde gösterilen
polimorfizmler
• Ulrich Wahn’ın makalesinden tablo 2 eklenecek.
Bierbaum S. ARJCCM 2005 Sep
yabanıl
C A A T C T A G G C
mutant
X geni promoter
Bölgesinde saptanan SNP
Jel görüntüsü
TTCAACCATTTT
TCCAACCATTCT
217
119
98
n
X geni
Normal
Heterezigot
Mutant
SAĞLIKLI
188
153 (0.814)
33 (0.176)
2 (0.011)
ASTIM
396
316 (0.798)
75 (0.189)
5 (0.013)
p
>0.05
KARDİOPULMONER
HASTALIKLARDA FENOTİPLER
Kardiovasküler
Koroner arter hst
İkincil
Hipertansiyon
Serum kolesterol
HLDL/LDL/Trigliserid
Sol vent hipertrofisi
Solunum
AstIM
İkincil
Bronş aşırı duyarlılığı
Serum IgE düzeyleri
Atopi
İnflamatuvar belirteçler
Solunum fonksiyonları
Astım şiddeti
45
40
mm + mw genotype
35
30
25
20
15
10
5
0
Kontrol
hafif
orta
ağır
İLİŞKİLENDİRME ÇALIŞMASI
(ASSOCIATION)
• Hastalık ve hastalık fenotipleri çok iyi
tanımlanmalı
• Büyük olgu kontrol grubu sağlanmalı
• Gelişigüzel (random) seçilmeli
• Olgu-kontrol grupları dengeli olmalı
• Fenotipler çok iyitanımlanmalı
TANIMLANAN SNP’İN
İŞLEVİ NE?
5'
Exon 1
Yabanıl tip
Mutant tip
Intron 1
Exon 2
Exon 3
3'
TGTTAGGGCCCCCCTCCCTGAA
TGTTAGGGTCCCCCTCCCTGAA
-159
TF
GGCCC
Intron 2
X
GGTCC
L u c ife r a s e
a c tiv ity
Transfection analysis with
PromoterReporter Construct - A549 cells n=4
450
400
350
300
250
200
150
100
50
0
ww
mm
PGL-3 basic
PGL-3 control
Constructs
Kalaycı O, AJRCMB 2003
astım genlerinin araştırılması (II)
Genom boyu tarama
+
Pozisyonel klonlama
Genom boyu tarama
Hastalığı taşıyan aileler
Polimorfik belirteçler
Hastalık ile kromozomal
bölge arasında istatistiksel
bağlantı (linkage analizi)
5q, 6p, 12q, 13q
Am J Hum Genet 2001;68:1437-1446
• 460 aile
• En az iki astımlı kardeş
• Genom boyu tarama + Linkage
analizi
• 20 kromozomun kısa kolunda
bir DNA bölgesi
Etkilenen kardeşlerde X1000
daha sık
• Polimorfik belirteçler
ADAM 33 20p13
Pozisyonel klonlama
• Fonksiyonunu bilmeksizin bir hastalık
geninin tanımlanması
• Bilinmeyen bir genin tanımlanması
astım genlerinin araştırılması (III)
Genom boyu polimorfizm taraması
ORMDL3
p=10-22
Endoplasmik retikulumda bulunan
transmembran protein
Astım ve atopi ile ilişkili fentotiplerle
>10 bağımsız çalışmada
ilişkili bulunan genler
•
•
•
•
•
•
•
•
•
•
IL-4
IL-13
CD14
ADRB2
HLA-DRB1
HLA-DQB1
TNF
FCεR1β
IL4Rα
ADAM 33
•
•
•
•
Astımın ailevi özelliği vardır.
Genetik polimorfizmler astım riskini etkiler
Çevresel faktörler astım riskini etkiler
Genetik yatkınlıkla çevresel faktörler
arasında çok sıkı bir ilişki vardır
Astma genetiği
• Astma genlerinin araştırılması
• Fizyopatoloji
• Presemptomatik tedavi
• Koruyucu tedavi
• Fonksiyonel genomik çalışmalar
• Farmakogenetik
Astım Farmakogenetiği
Genetik bilgiyi kullanarak hangi hastanın
tedaviye iyi / kötü yanıt vereceğini
saptamak
Populasyon değişkenliği
Montelukast
FEV1 12 hafta
Beclomethasone*
Plasebo
“izlem”
2 hafta
Çıft kör
Aktıf Tedavı
12 hafta
Malmstrom et al. Ann Intern Med. 1999;130:487-495.
FEV1
17
15
13
11
% değişiklik 9
(ort ± SE)
7
5
3
1
-1
-3
Beclomethasone
Montelukast
0
3
6
Hafta
9
12
Bazal=2.2 L
Malmstrom et al. Arch Intern Med. 1999;130:487-495.
Populasyon değişkenliği
30
25
Beclomethasone
Montelukast
Hastaların
yüzdesi 20
15
10
5
0
<-30
-30 to
<-20
-20 to -10 to
<-10
<0
0 to
<10
10 to
<20
20 to
<30
30 to
<40
40 to
<50
FEV1 Bazal değerden % değişiklik
Malmstrom et al. Ann Intern Med. 1999;130:487-495.
³50
I
V M S
L I
H
A A G F
I P V V
V
A
R
T S I
D
M Q I
E V Y
V I
N V
I
F F
L L N
T L G S
S F Y V
P L W C
Y V N S
P L V
L T F
G F N
I
T G M I
P L I
I
A C A L
L C V I
T A I
S T I
E T
Y
N
I
T
S
W
V M L I
A V D
R
Y
F
A
F
CTA)
V I
I
V
I
V T A S
V L D
84 (CTG
A S
K
V H
S I
V L V I
R L Q T V T
A I
I
R
L F S
F G N
E
P
D N L I
V L C
A L G M
A
K
F
AGG)
Q
N
Q A Y
Y W H
V
L A I
175 (CGG
F
T
V Y S
R
V
F
Q
E
A
K
N
K
L
P
F K Y Q S
Thr 164
(ACC
L
T
I
G L
T
K
G
Y
C R S
P
L
A
D
F R I
K H E
K L C
A K R Q L Q K
366 (TAT
R
R
TAC)
G S Q E G T N G N S S Y G N G Y A K L
V
E
L
C
L
S
L S Q V E Q D G R T G H G L
H
Q
E
L
F
S
N
Y
A F
K
I
V H F R G E S K D
Q
Ile
ATC)
¨
M V F
V R
W I
351 (GGG
Q E K E N K L L C E D L P G T E D F V
G
HOOC L L S D N T S C N R G Q S D I N D S P V T G
413 (CTG
R
R
S
S
GGC)
H
Q
←
G M G
T
←
←
ATG)
V
M
L I
F
W
C
E F W
K
←
←
(GTG
Met
M
D
F
H
←
V
W
V
Q
F G
W T
N
←
GAA)
E
E
T
C
C
I
A
E
Glu
←
(CAA
D
N
←
Gln 27
C
N
←
Q
R
GGA)
Y A
←
(AGA
T
Q
Gly
←
V
←
Arg 16
D
Val 34
β2AR Polimorfizmleri
D P A H S R N P A L L F A S G N G P Q G MNH2
H
CTA)
Liggett et al. AJRCCM, 1997
NHLBI BAGS ÇALIŞMASI
Salbutamol inhaler x4 +
Gerektikçe salbutamol
Run-in
6 hafta
Randomize kör tedavi
16 hafta
Placebo inhaler 4x+
Gerektikçe salbutamol
Run-out
4 hafta
Δ Sabah PEF (L/min)
BAGS Genetik Analiz
Arg/Arg-LH
10
5
0
-5
-10
-15
-20
-25
Gly/Gly-Düzenli
Arg/Arg-Düzenli
0
5
10
15
Randomizasyon sonrası hafta
Israel EJ et al., AJRCCM; 2000
20
SONUÇ
Genetik çalışmalar
astım tanı ve tedavisinde
önümüzdeki yılların en önemli beklentisidir
Download

astımda genetik çalışmalar