KANGAL ve GÜNEY KARAMAN KOYUNLARINDA FecB, FecXG, FecXH ALLELLERİNİN PZR-RFLP YÖNTEMİ
Lalahan
Hay. Araşt. Enst.
Derg. 2011, 51 (2) 71-80
KULLANILARAK
ARAŞTIRILMASI
KANGAL ve GÜNEY KARAMAN KOYUNLARINDA FecB, FecXG, FecXH ALLELLERİNİN
PZR-RFLP YÖNTEMİ KULLANILARAK ARAŞTIRILMASI
(An Investigation of Presence of FecB, FecXG, FecXH Allele in Kangal and Güney Karaman
Sheep Using PCR-RFLP Method)
Taki KARSLI1
Emine ŞAHİN1
Murat GÖKÇE EREN1
1
Bahar ARGUN KARSLI1
Murat Soner BALCIOĞLU1
Akdeniz Üniversitesi Ziraat Fakültesi Zootekni Bölümü, 07070 Antalya
Geliş Tarihi: 25.03.2011
Kabul Tarihi: 06.01.2012
ÖZET
Bazı koyun ırklarında tespit edilen majör gen allelleri ovulasyon oranını ve bir batında doğan yavru
sayısını artırmaktadır. Koyunlarda ovulasyon oranını etkileyen bu majör gen allelleri bir mutasyon sonucu
oluşmuştur. Ovulasyon oranını artırdığı bilinen başlıca mutasyonlar Bone Morphogenetic Protein ReceptorIB/BMPR–IB (FecB), Bone Morphogenetic Protein-15/BMP-15 (FecXB, FecXG, FecXH, FecXL, FecXR, FecXI)
ve Growth Differentiation Factor-9/GDF-9 genleri üzerindedir. Bu çalışmada Türkiye’de yetiştirilen Kangal ve
Güney Karaman koyunlarında FecB, FecXG ve FecXH alellerinin varlığı araştırılmıştır. Bu allelleri tespit etmek
amacıyla Kangal (42 örnek) ve Güney Karaman (29 örnek) koyunlarında toplam 71 örnek PZR-RFLP metodu
kullanılarak analiz edilmiştir. Sonuç olarak, incelenen 71 örnekte FecB, FecXG ve FecXH allelleri tespit
edilememiştir. Sonuç olarak incelenen 71 örnekte FecB, FecXG ve FecXH allelleri tespit edilememiştir.
Anahtar Kelimeler: BMPR-IB, BMP 15, çoklu doğum, koyun
SUMMARY
Major genes increase ovulation rate and litter size in some sheep breeds. Alleles of these major genes
affecting ovulation rate in sheep are the result of a mutations. Primary mutations that increase ovulation rate in
sheep were located on Bone Morphogenetic Protein Receptor IB/BMPR-IB (FecB), Bone Morphogenetic Protein
15/BMP-15 (FecXB, FecXG, FecXH, FecXL, FecXR, FecXI) and Growth Differentiation Factor 9/GDF-9 genes. In
this study, the presence of FecB, FecXG and FecXH allele were investigated in Kangal and Güney Karaman
sheeps reared in Turkey. In order to determine these allele in Kangal (n=42) and Güney Karaman (n=29) sheeps,
a totall 71 samples were analyzed by using PCR-RFLP method. As a result of examined in totally 71 samples
FecB, FecXH and FecXG allele were not determined.
Key Words: BMPR-IB, BMP 15, prolificacy, sheep
71
TAKİ KARSLI, EMİNE ŞAHİN, BAHAR ARGUN KARSLI, MURAT GÖKÇE EREN, MURAT SONER BALCIOĞLU
boyutlara ulaşmıştır. Verim özellikleri için
GİRİŞ
"majör genler" olarak adlandırılan büyük etkili
Koyun
yetiştiriciliği
Türkiye
genlerin belirlenmesi ve kullanımı genetik
hayvancılığı ve kırsal ekonomi açısından çok
ilerleme
önemlidir. Türkiye 2009 yılındaki yaklaşık 24
oranının
artırılması
için
önemli
potansiyel oluşturmaktadır. Majör genler bir
milyon koyun varlığı ile Avrupa ve dünyada
çift allel tarafından determine edilmekte ve
önemli paya sahiptir (3). TÜİK’in 2009 yılı
basit Mendel kalıtımı izlemektedir (5).
verilerine göre Türkiye’de toplam kırmızı et
Çiftlik hayvanlarında ekonomik önemi
üretiminin % 17.3’ü, süt üretiminin de % 6.1’i
olan özelliklerle ilgili bilinen majör genler
koyundan sağlanmaktadır (2).
içerisinde, koyunlardaki döl verimi ile ilgili
Türkiye koyun varlığının büyük bir
bölümünü
Akkaraman
olanlar öne çıkmış durumdadır. Koyunlarda
ırkı
koyun
çoklu doğumu etkileyen majör genler bir
oluşturmaktadır. Akkaraman koyun ırkının
mutasyon
değişik bölgelerde farklılık gösteren varyeteleri
sonucunda
oluşmuştur.
Çoklu
doğumu artırdığı bilinen başlıca mutasyonların
mevcuttur. Bunlardan Kangal lokal bir tip olup,
Bone Morphogenetic Protein Receptor IB
yoğun olarak Sivas ve Malatya illerinde
(BMPR-IB), Bone Morphogenetic Protein 15
yetiştirilmektedir. Akkaraman ırkının diğer bir
(BMP-15) ve Growth Differentiation Factor 9
varyetesi olduğu düşünülen Güney Karaman
(GDF-9) genleri üzerinde olduğu bildirilmiştir
(Karakoyun) ise Güney Toroslar bölgesinde
(8, 9).
yetiştirilmektedir. Güney Karamanlar genel
Koyunlarda ovulasyon oranını ve buna
olarak siyah, kahverengi, gri, beyaz veya siyah
bağlı olarak bir batında doğan yavru sayısını
alaca renklidir (31). Göçer sistemle yetiştirilen
artırdığı belirlenen ilk majör gen Avustralya
Güney Karaman koyun ırkı yok olma tehdidi
altında
bulunduğu
Hayvancılık
için
Bakanlığı
Gıda
Tarım
tarafından
ve
gen
Booroola
Merinoslarında
Booroola
genidir.
heterezigot
kaynaklarının korunması kapsamına alınan
ise
Et, süt, döl verimi gibi kantitatif
ovulasyon
için
oranı
kat
fazla
olmaktadır.
Ovulasyon
(8). İnsanda BMPR-IB gen bölgesinin baz
karakterlerin temel kalıtımı, ilgili genlerin
dizilimi ile koyunlarda 6. kromozom üzerinde
etkileri toplamı ile açıklanmıştır (16). Ancak
hayvanların
3
sayısını sırasıyla %100 ve %150 artırmaktadır
şekillenir. Yani kalıtımı poligeniktir. Kantitatif
evcil
hayvanlarda
geni
oranındaki bu artış bir batında doğan yavru
karakterler çok sayıda genin etkilerine göre
yıllarda
Booroola
edilen
(koyun başına) 1.5 kat, homozigot hayvanlarda
koyun ırklarındandır (1).
son
tespit
bulunan Booroola gen bölgesinin dizilimi
verim
aynıdır ve bu genin 746. nükleotidinde adenin
özelliklerinin poligenik olmakla birlikte kimi
ile guanin bazlarının yer değiştirmesine bağlı
majör gen etkilerinin de (poligen+majör gen)
olarak glutamin amino asiti yerine arginin
söz konusu olduğuna ilişkin bilgiler ilgi çekici
amino asidi kodlanmaktadır. Koyunlardaki
72
KANGAL ve GÜNEY KARAMAN KOYUNLARINDA FecB, FecXG, FecXH ALLELLERİNİN PZR-RFLP YÖNTEMİ
KULLANILARAK ARAŞTIRILMASI
BMPR-IB geninde meydana gelen bu nokta
gösterilmelidir. Ayrıca her bir bireyin söz
mutasyonu
allel
konusu lokustaki genotipinin belirlenmesi ve
fekonditeyi artırdığı için FecB geni olarak
çiftleşme planlarının buna göre yapılması
adlandırılmaktadır. Ayrıca ilk olarak Booroola
gerekir (4).
sonucu
yeni
oluşan
koyunlarında tespit edildiği için Booroola geni
Moleküler genetik alanındaki gelişmeler,
de denilmektedir (25, 29, 32).
ekonomik
özelliklerin
ortaya
çıkmasını
BMP-15 geni X kromozomu üzerinde
sağlayan gen bölgelerinin veya majör genlerin
haritalanmış ve şu ana kadar bu gen üzerinde
tespitine olanak vermektedir. Bu durum,
farklı mutasyonlar sonucu meydana gelen altı
seleksiyon
allel
belirlenmiştir.
Bu
alleller
I
FecX
dönemde
tespit
özelliklerin
edilmesini
erken
sağlamaktadır.
Hayvan ıslahında kullanılan bu genler hem dişi
(Inverdale), FecXH (Hanna), FecXG (Galway),
B
yapılacak
R
FecX (Belclare), FecX (Rasa Aragonesa) ve
hem de erkek hayvanlarda, doğumdan hemen
FecXL (Lacaune) olarak adlandırılmıştır (13,
sonra saptanabilir. Bu durum seleksiyonla
24, 32). Bu allellerin hepsi fenotip üzerinde
sağlanacak genetik ilerlemenin daha fazla
benzer etkilere sahiptir. BMP-15 genindeki
olmasına olanak tanımakta ve Marker Destekli
herhangi bir allel için heterozigot hayvanlarda
Seleksiyon (MAS = Marker Asisted Selection)
ovulasyon oranı bu alleli taşımayanlara göre
olarak adlandırılmaktadır (26).
1-1.5 kat daha fazla olmaktadır. BMP-15
Majör
genindeki bu allellerden birini homozigot
oluşur.
Ancak
BMP-15
genindeki
temeli
olduğu nokta mutasyonlarıdır. Nadir olarak
folliküllerin
BMP 15 genindeki FecXR alleli gibi delesyon
gelişememesinden dolayı bu hayvanlar kısır
olmaktadır.
moleküler
genellikle tek nükleotid değişimlerinin neden
olarak taşıyan hayvanlarda ise çok sayıda
follikül
genlerin
mutasyonu sonucu oluşan majör genlerde
Hanna
vardır.
mutasyonuna BMP 15 geni üzerinde 67.
Eğer
mutasyonu
içeren
bölgeyi
çoğaltacak primerler ve mutasyonu tanıyan
pozisyonda C ile T arasındaki baz değişimi
restriksiyon enzimi (RE) biliniyorsa nokta
neden olur. Bu nükleotid değişimi ise glütamik
mutasyonlarının belirlenmesinde kullanılan en
asit (Glu) yerine stop kodonu oluşturarak
yaygın DNA marker yöntemi Polimeraz Zincir
proteinin vaktinden önce sonlandırılmasına
Reaksiyonu - Restriksiyon Uzunluk Parça
neden olur. Galway mutasyonuna ise BMP-15
Polimorfizmi) (PZR-RFLP) metodudur.
geninde 718. pozisyonda benzer olarak C ile T
Bu çalışma, Kangal ve Güney Karaman
arasındaki baz değişimi neden olur. Bu
koyunlarının FecB, FecXH ve FecXG allellerini
nükleotid değişimi glütamin (Gln) yerine erken
taşıyıp taşımadıklarının belirlenmesi amacıyla
bir stop kodonu oluşmasını sağlar (10, 13, 22).
yapılmıştır.
Majör genler tarafından sağlanan verim
artışından en üst düzeyde yararlanabilmek için
öncelikle bu genlerin varlığı ve etki düzeyleri
73
TAKİ KARSLI, EMİNE ŞAHİN, BAHAR ARGUN KARSLI, MURAT GÖKÇE EREN, MURAT SONER BALCIOĞLU
MATERYAL VE METOT
Araştırmanın
primerler ile PZR’da çoğaltıldığında, FecB
hayvan
alleli için 190, FecXH alleli için 240 ve FecXG
materyalini
alleli için 141 baz çifti (bç) uzunluğunda
oluşturan Kangal koyunlarına ait örnekler
Kahramanmaraş
ili
Elbistan
bantların elde edilmesi beklenmektedir. PZR
ilçesindeki
işlemi ilk denatürasyon 95˚C’de 5 dak,
işletmelerden, Güney Karaman koyunlarına ait
denatürasyon 95˚C’de 40 sn, yapışma FecB ve
örnekler ise Antalya ili Manavgat ve Serik
FecXG alleli için, 62˚ C’de 40 sn, FecXH alleli
ilçelerindeki işletmelerden rasgele seçilerek
için 57˚C’de 30 sn, uzama 72˚ C’de 45 sn, son
toplanmıştır.
uzama ise 72˚C’de 5 dk olmak üzere 30 döngü
Kan Örneklerinin Alınması
olarak uygulanmıştır. PZR reaksiyon karışımı
DNA izolasyonu için kullanılacak kan
örnekleri
Vena
jugularisten
kullanımlık iğnelerle 10
steril
ve
tek
kullanılan
miktarlar
Çizelge
2’de
gösterilmiştir.
ml’lik EDTA’lı
PZR işlemi sonunda elde edilen PZR
tüplere alınmıştır. Alınan kan örnekleri soğuk
ürünleri, FecB allelini belirlemek için AvaII
zincirde Akdeniz Üniversitesi Ziraat Fakültesi
(G/GACC), FecXH alleli için AhlI (A/CTAGT),
Zootekni Bölümü Genetik Laboratuarına en
FecXG alleli için HinfI (G/ANTC) restriksiyon
kısa sürede getirilmiş ve DNA izolasyonu
enzimleri ile kesime bırakılmıştır. Kesim
yapılana kadar -20˚C’de korunmuştur.
işlemi 10µl PZR ürünü, 10U kesim enzimi,
Genomik DNA İzolasyonu
2.5 µl enzim buffer ve 2.5 µl H2O olmak üzere
15 µl hacminde, 37˚C’de 3 saat olarak
Genomik DNA, ticari bir DNA izolasyon
uygulanmıştır. Kesim sonrasında FecB allelini
kiti (Sigma Aldrich, USA) kullanılarak izole
homozigot olarak bulunduran bireylerde 160
edilmiştir. Elde edilen DNA’ların kalitatif ve
kantitatif
özellikleri,
spektrofotometre
bç uzunluğunda tek bant, heterezigot bireylerde
ve
190bç
%1’lik agaroz jellerde belirlenmiş daha sonra
DNA’lar
50
ng/µl
olacak
bulunması
şekilde
gerekir.
uzunluğunda
Bu
alleli
iki
bant
taşımayan
ürünleri kesilmeden kalır. FecXH alleli için
PZR-RFLP İşlemi
kesim işleminden sonra normal bireylerde 240
PZR işlemi için daha önce yapılan
incelenmiş
160bç
bireylerde ise 190 bç uzunluğundaki PZR
seyreltilmiştir.
çalışmalar
ve
ve
Çizelge’1
bç uzunluğundaki PZR ürünleri kesilmeden
de
kalırken mutasyonu taşıyan bireylerde 218 bç
gösterilen primerler kullanılmıştır. DNA’lar bu
ve 22 bç uzunluğunda iki bant olması gerekir.
74
KANGAL ve GÜNEY KARAMAN KOYUNLARINDA FecB, FecXG, FecXH ALLELLERİNİN PZR-RFLP YÖNTEMİ
KULLANILARAK ARAŞTIRILMASI
Çizelge 1. PZR işleminde kullanılan primerler
Gen
Allel
BMPR-IB
FecB
FecXH
BMP-15
FecXG
Primer Primer Sekansı (5’- 3’)
Kaynak
FB
CCAGAGGACAATAGCAAAGCA AA
9, 17
RB
CAAGATGTTTTCATGCCTCATCAACACGGTC
FH
TATTTCAATGACACTCAGAG
RH
GAGCAATGATCCAGTGATCCCA
FG
CACTGTCTTCTTGTTACTGTATTTCAATGAGAC
RG
GATGCAATACTGCCTGCTTG
14, 30
14, 18
Çizelge 2. PZR reaksiyon karışımı,
miktar ve markaları
uzunluğundaki PZR ürünleri HinfI enzimi ile
Bileşen
Miktar
29 bç uzunluğunda iki bant elde edilmiştir
H2O
32.8
MgCl2
4µl
Bioron25mM
PZR ürünleri AhlI restriksiyon enzimi ile
10X buffer
4µl
Bioron 25mM
kesime bırakılmış ancak 240 bç uzunluğundaki
dNTPs
5µl
Larova 2.5mM
PZR ürünleri kesilmeden kalmıştır (Şekil 3).
F Primer
0.6µl
MWG 0.2 µmol
Sonuç olarak incelenen 71 örnekte FecB,
R Primer
0.6µl
MWG 0.2 µmol
FecXH ve FecXG allelleri tespit edilememiştir.
Taq
1U
Bioron
DNA
3µl
~ 50 ng/μl
kesime bırakılmıştır. Kesim sonunda 112 bç ve
Marka-Molarite
(Şekil 2). FecXH alleli için 240 bç uzunluğunda
FecXG alleli için kesim işleminden sonra
normal
bireylerde
112
bç
ve
29
bç
uzunluğunda iki bant oluşurken mutasyonu
Şekil 1. FecB alleli için PZR ürünlerinin
AvaII restriksiyon enzimi ile kesimi (% 2
agaroz jel, M: DNA Marker-FermentaseKat.No: SM1191).
taşıyan bireylerde 141 bç uzunluğundaki PZR
ürünleri kesilmeden kalmaktadır.
BULGULAR
PZR işlemi sonunda FecB alleli için 190
bç, FecXG alleli için 141 bç ve FecXH alleli
için
240
edilmiştir.
bç
uzunluğunda
FecB
uzunluğundaki
alleli
bantlar
bantlar
için
AvaII
190
elde
bç
restriksiyon
enzimi ile kesime bırakılmış ancak 160 bç
uzunluğundaki
(Şekil
1).
bantlar
FecXG
elde
alleli
Şekil 2. FecXG alleli için PZR
ürünlerinin HinfI restriksiyon enzimi ile kesimi
(% 4’lük agaroz jel, M: DNA MarkerFermentase-Kat.No: SM1191)
edilememiştir
için
141
bç
75
TAKİ KARSLI, EMİNE ŞAHİN, BAHAR ARGUN KARSLI, MURAT GÖKÇE EREN, MURAT SONER BALCIOĞLU
saptamıştır.
Bunun
sebebinin
embriyo
ölümleri, BMPR-IB geninin ifade edilememesi,
besleme
faktörlerine
bağlı
hormonel
dengesizlik ve bilinmeyen çevre faktörleri
olabileceğini belirtmişlerdir. Türkiye’de koyun
yetiştiriciliği genellikle meraya dayalı ve kötü
çevre koşullarında yapılmaktadır. Bu nedenle
Şekil 3. FecXH alleli için PZR
ürünlerinin AhII restriksiyon enzimi ile kesimi
(% 2 agaroz jel, M: DNA Marker-Bioron
Kat.No:306005).
Türkiye’de
yetiştiriciliği
yapılan
koyun
ırklarında çoklu doğum oranı düşük olsa bile,
majör genler bakımından DNA düzeyinde
incelenmesinde fayda görülmektedir. Booroola
TARTIŞMA VE SONUÇ
geninden farklı olarak BMP 15 geni homozigot
Geçtiğimiz on yılda koyunlarda döl
hayvanlarda kısırlığa neden olması bakımından
verimi üzerine etkili majör genlerle ilgili
da araştırılmalıdır.
yapılan çalışmalar önemli ölçüde artmıştır.
Türkiye’de konu ile ilgili şu ana kadar
Booroola Merinoslarında tespit edilen FecB
yapılan çalışmalarda Polat (27) Sakız ve Sakız
alleli için DNA marker testi geliştirilmesi, hem
X
bu genin başka koyun ırklarında aranmasına
temelinde
tespit
melezlerinde
FecB
allelini
belirleyememiştir. Karslı ve Balcıoğlu (17)
olanak sağlamış hem de başka majör genlerin
DNA
Kıvırcık
Akkaraman,
edilebileceğini
Morkaraman,
Dağlıç,
İvesi,
Karakaş ve Tuj koyunlarında FecB allelini
göstermiştir. Dünya üzerinde birçok koyun
ırkında (7, 12, 15, 18) ve son zamanlarda bazı
tespit edememiştir. Bu çalışmada da benzer
keçi ırklarında (14, 28, 30) majör genlerin
olarak FecB alleli tespit edilememiştir. Diğer
çalışmalardan farklı olarak Kangal ve Güney
varlığı moleküler olarak araştırılmıştır.
Karaman koyunlarının BMP 15 genindeki
Booroola geni şu ana kadar Booroola
FecXH ve FecXG allellerini de taşımadığı
Merinosu, Garole, Javanese, Hu, Han ve
gösterilmiştir.
Kendrapada koyunlarında (6, 9, 19, 21) tespit
edilmiştir.
BMP-15
geni
ise
Elde edilen sonuçlar Michailidis ve ark.
Belclare,
(23) tarafından Yunan Sakız ve Florina
Cambridge, Romney, Han ve Rasa Aragonesa
(6, 8, 13, 24) koyun ırklarında tespit edilmiştir.
koyunlarında FecB alleli, Kasariyan ve ark.
Önceleri sadece prolifik ırklarda bu
FecB ve FecXG alleli, Kumar ve ark (20)
(18) tarafından İran Sangsari koyun ırkında
genlerin varlığı araştırılırken (7, 9, 19), son
yıllarda
prolifik
olmayan
ırklarda
tarafından
Marwari
ve
Bharat
Merino
da
koyunlarında FecB alleli ve Ghaffari ve ark.
araştırılmıştır (15, 18, 23). Kumar ve ark. (19)
(11) tarafından Shal koyunlarında FecB alleli
Garole
için
koyunlarında
bazı
bireylerin
tek
kuzulamasına rağmen FecB taşıyıcısı olduğunu
yapılan
benzerdir.
76
çalışmaların
sonuçlarıyla
KANGAL ve GÜNEY KARAMAN KOYUNLARINDA FecB, FecXG, FecXH ALLELLERİNİN PZR-RFLP YÖNTEMİ
KULLANILARAK ARAŞTIRILMASI
Kumar ve ark. (19) Garole, Garole X
kadar araştırma yapılan ırkın özelliklerini
Malpura melezi ve Malpura koyunlarında
yansıtan saf yetiştirilmiş bireyler kullanılması
PZR-RFLP
da önemlidir.
yöntemi
kullanarak
yaptıkları
araştırmada Garole ve Garole X Malpura
Türkiye’de yetiştirilen bazı yerli koyun
melezlerinde FecB allelini tespit etmiş ancak
Malpura
koyunlarında
bu
geni
ırklarında şu ana kadar yapılan çalışmalarda
tespit
herhangi
edememiştir. Davis ve ark. (9) 13 ülkeden 21
ırklarının incelenen
sadece Hu ve Han koyun ırklarında bu alleli
etmiştir.
Chu
ve
ark.
(6)
FecXG
allelini
Kendrapada
koyunlarında
Deccani,
FecXG
bakımından
durumunda döl verimi için yapılan ıslah
çalışmalarında kullanılabilir. Bu genlerin tespit
edilememesi durumunda ise bu genleri taşıyan
ve
mevcut ırkların ya da spermalarının ithal
allelini
edilerek majör genlerin yerli ırklara aktarılması
belirleyememiştir.
Bu
özellikler
incelenmelidir. Bu genler tespit edilmesi
Kendrapada koyunlarında FecB allelini tespit
Malpura,
tespit
tüm koyun ırkları majör genler bakımından
taşıdığını
yetiştirilen çeşitli ırklarla yaptıkları çalışmada
Garole,
varlığı
önemlidir. Türkiye’de yetiştiriciliği yapılan
göstermiştir. Kumar ve ark. (21) Hindistan’da
etmiş,
genin
genetik yapısının ortaya konulması bakımından
Han
koyunlarının hem FecB allelini hemde BMP 15
genindeki
majör
edilememiştir. Ancak bu çalışmalar yerli koyun
koyun ırkında FecB allelini aramış ancak
tespit
bir
düşünülebilir. Bu sayede yerli ırkların çoklu
Karaman
doğum oranlarının artması buna bağlı olarak
koyunlarında 29 örnek, Kangal koyunlarında
kasaplık kuzu üretimi yapan işletmelerin
42 örnek olmak üzere toplam 71 örnek
büyütülmesi ve yaygınlaştırılması sağlanabilir.
üzerinde uygulanmıştır. Elbette örnek sayısının
Ancak bu işlem yapılırken yerli ırkların
artırılması bu allelleri bulma olasılığını artırır.
fizyolojik özellikleri ve yetiştirildikleri çevre
Yapılan diğer çalışmalar örnek büyüklükleri
koşulları göz önüne alınarak en uygun prolifik
bakımından
ırk seçilmelidir.
farklılıklar
araştırma,
Güney
karşılaştırıldığında
göze
çarpmaktadır.
büyük
Örneğin
Michailidis ve ark. (23) tarafından Yunan
Sakız
ve
Florina
koyunlarında
KAYNAKLAR
yapılan
1.
araştırmada 25 örnek, Kasariyan ve ark. (18)
Anonim (2006): Hayvancılığın desteklenmesi
tarafından yapılan araştırmada ise 150 örnek
hakkında uygulama esasları tebliği (Tebliğ No:
kullanılmıştır. Davis ve ark. (9) tarafından Hu
2006/9- http://rega.basbakanlik.gov.tr/, Erişim
ve Han koyunlarında yapılan çalışmada sadece
Tarihi: 29.06.2008).
12 örnekle FecB allelinin tespit edildiği
2.
düşünülecek olursa bu çalışmada kullanılan
Anonim
(2009):
(TÜİK-www,tuik.gov.tr,
Erişim Tarihi: 22. 02. 2011).
örnek sayısının yeterli olduğu söylenilebilir.
Bu tip çalışmalarda örnek sayısının çok olması
77
TAKİ KARSLI, EMİNE ŞAHİN, BAHAR ARGUN KARSLI, MURAT GÖKÇE EREN, MURAT SONER BALCIOĞLU
3.
4.
(FAOSTAT-
and Inverdale (FecXI) mutations in 21 prolific
http://faostat.fao.org/, Erişim Tarihi: 22. 02.
breeds and strains of sheep sampled in 13
2011).
countries. Animal Reproduction Science, 92:
Cemal İ (1996): Çiftlik Hayvanlarında Majör
87–96.
Anonim
(2009):
Genler Bunların Belirlenmesi, Transferi ve
Endüstriyel
Yüzüncü
5.
Kullanımı.
Yıl
Y.
Üniversitesi,
Lisans
Fen
10. Galloway SM, Mcnatty KP, Cambridge LM,
Tezi.
Laitinen MPE, Juengell JL, Jokıranta TS,
Bilimleri
Mclaren RJ, Luiro K, Montgomery GW,
Enstitüsü, Van.
Beattle AE, Davis GH, Ritvos O (2000):
Cemal İ, Karaca O, Atay O (1996):
Mutations in an oocyte-derived Growth Factor
Gene (BMP15) cause increased ovulation rate
Koyunlarda Döl Verimine Etkili Majör Genler.
and infertility in a dosage-sensitive manner.
Yüzüncü Yıl Üniversitesi Ziraat Fakültesi
Nature Genetics 25: 279-283.
Dergisi, 6(4) 31-48.
6.
11. Ghaffari M, Javaremi AN, Rahimi G (2009):
Chu MX, Liu ZH, Jiao CL, He YQ, Fang L,
Detection of Polymorphism in BMPR-IB Gene
Ye, SC, Chen GH, Wang JY (2007): Mutation
Associated with Twining in Shal Sheep using
in BMPR-IB and BMP-15 genes are associated
PCR-RFLP Method. International Journal of
with litter size in small tailed Han sheep (Ovis
Agriculture & Biology, 11: 97-99.
aries). Journal of Animal Science 85: 598-603.
7.
12. Guan F, Liu, SR, Shi GQ, Yang LG (2007):
Davis GH, Galloway SM, Ross IK, Gregan
Polymorphism of FecB gene in nine sheep
SM, Ward J, Nimbkar BV, Ghalsasi PM,
Nimbkar
C,
Gray
DG,
Inounu
breeds or strains and its effects on litter size,
I,
lamb
Tiesnamurti B, Martyniuk E, Eythorsdottir
and
development.
Animal
Reproduction Science, 99: 44–52
E, Mulsant P, Lecerf F, Hanrahan JP,
8.
growth
Bradford GH, Wilson T (2002): DNA tests in
13. Hanrahan JP, Gregan MS, Mulsant P,
prolific sheep from eight countries provide new
Mullen M, Davis GH, Powel R, Galloway
evidence on origin of the Booroola (FecB)
SM (2004): Mutation in the genes for oocyte
mutation. Biology of Reproduction, 66: 1869–
derived growth factors GDF9 and BMP15 are
1874.
associated with both increased ovulation rate
and sterility in Cambridge and Belclare sheep
Davis GH (2004): Fecundity genes in sheep.
(Ovis aries). Biology of Reproduction, 70: 900-
Animal Reproduction Science, 82-83, 247-253
909.
9.
Davis GH, Balakrishnan L, Ross IK, Wilson
14. Hua GH, Chen SL, Ai JT, Yang LG (2008):
T, Galloway SM, Lumsden JM, Hanrahan
None of polymorphism of ovine fecundity major
JP, Mullen M, Mao XZ, Wang GL, Zhao ZS,
genes FecB and FecX was tested in goat.
Zeng YQ, Robinson JJ, Mayrogenis AP,
Animal Reproduction Science, 108: 279–286.
Papachristoforou C, Peter C, Baumung R,
Cardyn P, Boujenane I, Cockett NE,
15. Jamshidi R, Kasariyan MM, Hafezeyan H
Eythorsdottir E, Arranz JJ, Noter DR
(2009): Application of PCR-RFLP Teqnique to
(2006): Investigation of the Booroola (FecB)
determine BMP 15 gene polymorphism in
78
KANGAL ve GÜNEY KARAMAN KOYUNLARINDA FecB, FecXG, FecXH ALLELLERİNİN PZR-RFLP YÖNTEMİ
KULLANILARAK ARAŞTIRILMASI
Sangsari sheep breed of Iran. Journal of
22. McNatty KP, Smith P, Moore LG, Reader
Animal Veterinary Advances, 8 (10) 1906-
K, Lun S, Hanrahan JP, Groome NP,
1910.
Laitinen M, Ritvos O, Juengel JL (2005):
Oocyte-expressed genes affecting ovulation
16. Karaca O, Cemal İ, Atay O (1996):
rate. Molecular and Cellular Endocrinology,
Hayvancılıkta Kimi Majör Genlerin Aktarımı
234: 57-66.
Kullanım Olanakları. Hayvancılık’96 Ulusal
Kongresi 18-20 Eylül 1996, Ege Üniversitesi,
23. Michailidis G, Avdi M, Pappa V (2008):
Bornova, İzmir. 728-732.
Reproductive performance and investigation of
BMPR-IB and BMP-15 gene mutations in
17. Karslı T, Balcıoğlu MS (2010): Türkiye’de
Greek Chios and Florina sheep breeds.
Yetiştirilen Altı Yerli Koyun Irkında BMPR-IB
Archiva Zootechnica, 11(1) 24-31.
(Booroola) Geninde FecB Allel Varlığının
PCR-RFLP Yöntemiyle Araştırılması. Kafkas
24. Monteagudo LV, Ponz R, Tejedor MT,
Üniversitesi Veteriner Fakültesi Dergisi, 16(6)
Lavina A, Sierra I (2009): A 17 bp deletion in
1033-1066.
the Bone Morphogenetic Protein 15 (BMP15)
gene is associated to increased prolificacy in
18. Kasariyan MM, Hafezeyan H, Sayahzadeh
the Rasa Aragonesa sheep breed. Animal
H, Jamshidi R, Asghari SR, Irajeyan GH,
Reproduction Science, 110: 139–146.
Buesagh H (2009): Genetic Polymorphism
FecB and BMP15 Genes and Its Association
25. Mulsant P, Lecerf F, Fabre S, Schibler L,
with Litter Size in Sangsari Sheep Breed of
Monget P, Lenneluc I, Pisselet C, Riquet J,
Iran. Journal of Animal Veterinary Advances,
Monniaux
8 (5) 1025-1031.
Thimonieri J, Teyssieri J, Bodin L, Cognie
D,
Calebaut
I,
Cribıu
E,
Y, Chitour N, Elsen JM (2001): Mutation in
19. Kumar S, Kolte AP, Mishra AK, Arora AL,
bone morphogenetic protein receptor-IB is
Singh VK (2006a): Identification of the FecB
associated with increased ovulation rate in
mutation in Garole Malpura sheep and its
Booroola Merino ewes. Proc Natl Acad Sci, 98,
effect on litter size. Small Ruminant Research,
5104-5109.
64: 305-310.
26. Öner Y, Elmacı C (2007): Keçilerde Süt
20. Kumar S, Kolte AP, Singh VK (2006b):
Proteinleri Polimorfizmi. Hayvansal Üretim, 48
Twinning in Marwari and Bharat Merino ewes
(2) 49-54.
and its relationship with Booroola FecB
27. Polat YO (2006): Sakız koyun ırkında BMPR-
mutation. Indian Journal of Biotecnology, 5:
482-485.
IB geninde çoklu doğuma neden olabilecek
FecB alleli varlığının PCR-RFLP yöntemi ile
21. Kumar S, Mishra AK, Kolte AP, Dash SK,
araştırılması. Doktora tezi. Uludağ Üniv Sağlık
Karim SA (2008): Screening for Booroola
Bil Enst, Bursa.
(FecB) and Galway (FecXG) mutations in
Indian sheep. Small Ruminant Research, 80:
28. Polley S, De S, Batabyal S, Kaushik R,
57–61.
Yadav P, Arora JS, Chattopadhyay S, Pan
S, Brahma B, Datta T, Goswami SL (2009):
79
TAKİ KARSLI, EMİNE ŞAHİN, BAHAR ARGUN KARSLI, MURAT GÖKÇE EREN, MURAT SONER BALCIOĞLU
Polymorphism of fecundity genes (BMPR1B,
31. Tufan M, Akmaz A (2001): Güney Karaman
BMP15 and GDF9) in the Indian prolific Black
(Karakoyun),
Kangal-Akkaraman
Bengal goat. Small Ruminant Research, 85:
Akkaraman Kuzularının Farklı Kesim ve
122–129.
Karkas
Ağırlıklarında
Kesim
ve
ve
Karkas
Özellikleri. Turkish Journal of Veterinary and
29. Souza CJH, Macdougall C, Campbell BK,
Animal Sciences, 25: 495-504.
Mcneilly AS, Baird DT (2001): The booroola
(FecB) phenotype is associated with a mutation
32. Wilson T, Wu XY, Juengel JL, Ross IK,
in the bone morphogenetic receptor type IB
Lumsden M, Lord EA, Dodds KG, Walling
(BMPRIB) gene. Journal Endocrinology, 169
GA, McEwan JC, O’connel AR, Mcnatty
(2) 1-6.
KP,
intracellular
Daliri M, Kohram H, Javaremi AN (2009):
African
Journal
(2001):
Highly
kinase
domain
of
bone
morphogenetic protein IB receptor (ALK-6)
Study of BMP-15 gene polymorphism in
goats.
GW
prolific Booroola sheep have a mutation in the
30. Tajangookeh HD, Shahneh AZ, Zamiri MJ,
Iranian
Montogomery
that is expressed in both oocytes and granulosa
of
cells. Biology of Reproduction, 64: 1225-1235.
Biotechnology, 8 (13) 2929-2932.
80
Download

71 KANGAL ve GÜNEY KARAMAN KOYUNLARINDA FecB, FecXG